9530077C05RIK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

9530077C05RIK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1560 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus RIKEN cDNA 9530077C05 gene.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

9530077C05RIK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

1110003N12Rik cDNA ORF Clone, Mouse; Kiaa0895 cDNA ORF Clone, Mouse; mKIAA0895 cDNA ORF Clone, Mouse

9530077C05RIK Background Information

Full Name
RIKEN cDNA 9530077C05 gene
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait