휴먼 AADAC/arylacetamide deacetylase Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
    휴먼 AADAC cDNA 클론 제품 정보
    Gene_bank_ref_id:
    cDNA 크기:
    cDNA 설명:
    유전자 동의어:
    :Human
    벡터:
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with AADAC qPCR primers for gene expression analysis, HP100612 )
    Promoter:
    Application:
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:
    Shipping_carrier:
    보관:
    pCMV/hygro Vector Information
     
    Vector Name pCMV/hygro
    Vector Size 5657bp
    Vector Type Mammalian Expression Vector
    Expression Method Constiutive ,Stable / Transient
    Promoter CMV
    Antibiotic Resistance Ampicillin
    Selection In Mammalian Cells Hygromycin
    Protein Tag None
    Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)


    Schematic of pCMV/hygro Multiple Cloning Sites
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".