AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10639-M-F
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All AADAC/arylacetamide deacetylase Reagents
CRO Services
Product recommended

All AADAC/arylacetamide deacetylase Reagents
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1200 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human arylacetamide deacetylase (esterase) with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI (5.4kb + 1.25kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
AADAC/arylacetamide deacetylase cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human AADAC/arylacetamide deacetylase Gene Expression validated Image 1583
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CES5A1 cDNA ORF Clone, Human;DAC cDNA ORF Clone, Human
AADAC/arylacetamide deacetylase Background Information
Full Name
arylacetamide deacetylase

AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AADAC/arylacetamide deacetylase cDNA ORF Clone in Cloning Vector, Mouse MG50243-M
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, untagged MG50243-UT
AADAC/arylacetamide deacetylase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50243-ACGLN
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50243-ACG
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50243-ACR
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50243-CF
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50243-NF
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, C-His tag MG50243-CH
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, N-His tag MG50243-NH
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, C-HA tag MG50243-CY
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, N-HA tag MG50243-NY
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, C-Myc tag MG50243-CM
AADAC/arylacetamide deacetylase cDNA ORF Clone, Mouse, N-Myc tag MG50243-NM
AADAC/arylacetamide deacetylase qPCR Primer Pairs, Mouse MP200269

AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AADAC/arylacetamide deacetylase cDNA ORF Clone in Cloning Vector, Human HG10639-M
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, untagged HG10639-UT
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-GFPSpark® tag HG10639-ACG
AADAC/arylacetamide deacetylase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10639-ACGLN
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-OFPSpark® tag HG10639-ACR
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10639-CF
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10639-NF
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-His tag HG10639-CH
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, N-His tag HG10639-NH
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-HA tag HG10639-CY
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, N-HA tag HG10639-NY
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, C-Myc tag HG10639-CM
AADAC/arylacetamide deacetylase cDNA ORF Clone, Human, N-Myc tag HG10639-NM
AADAC/arylacetamide deacetylase qPCR Primer Pairs, Human HP100612
info info
添加购物车成功! 添加购物车失败!