ABHD11 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

ABHD11 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
480 bp
Description
Full length Clone DNA of Human abhydrolase domain containing 11
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About ABHD11

Entrez Gene ID

ABHD11 cDNA ORF Clone, Human, untagged: Alternative Names

PP1226 cDNA ORF Clone, Human; WBSCR21 cDNA ORF Clone, Human

ABHD11 Background Information

ABHD11 (α/β-hydrolase domain containing 11) is a non-annotated enzyme belonging to the family of metabolic serine hydrolases (mSHs).Mammalian alpha/beta hydrolase domain (ABHD) family of proteins have emerged as key regulators of lipid metabolism and are found to be associated with human diseases. Human α/β-hydrolase domain containing protein 11 (ABHD11) has recently been predicted as a potential biomarker for human lung adenocarcinoma.  
Full Name
abhydrolase domain containing 11
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait