휴먼 APOC2/Apolipoprotein CII Gene ORF cDNA clone expression plasmid

  • Human APOC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
휴먼 APOC2 cDNA 클론 제품 정보
cDNA 크기:
cDNA 설명:
유전자 동의어:
제한 사이트:
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:( We provide with APOC2 qPCR primers for gene expression analysis, HP104799 )
휴먼 APOC2 Gene Plasmid Map
Human APOC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".