Text Size:AAA

휴먼 BNIP3L Gene ORF cDNA clone expression plasmid

Human BNIP3L cDNA 클론 제품 정보
cDNA 크기:
cDNA 설명:
유전자 동의어:
제한 사이트:
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Human BNIP3L Gene Plasmid Map
Human BNIP3L Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
  • Imazu T, et al. (1999) Bcl-2 / E1B 19 kDa-interacting protein 3-like protein (Bnip3L) interacts with bcl-2 / Bcl-xL and induces apoptosis by altering mitochondrial membrane permeability. Oncogene. 18(32): 4523-9.
  • Sun JL, et al. (2004) Expression and structure of BNIP3L in lung cancer. Ai Zheng. 23(1): 8-14.
  • Contact Us
    • Human BNIP3L Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".