After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 CALML3 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human CALML3 cDNA 클론 제품 정보
Gene_bank_ref_id:
cDNA 크기:
cDNA 설명:
유전자 동의어:
:Human
벡터:
제한 사이트:
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:
보관:
Human CALML3 Gene Plasmid Map
Human CALML3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
연구배경

Calmodulin-like protein 3 (CALML3) is similar to that of authentic calmodulin and may actually compete with calmodulin by binding, with different affinity, to cellular substrates. Calmodulin-like protein 3 (CALML3) is a tumor-sensitive protein specifically expressed in normal epithelial cells but downregulated in tumorigenesis. Downregulation of the protein is an early event in breast cancer development. One of the most pressing questions raised by the discovery of CLP/CALML3 is that of its potential targets. Although it is 85% identical to human calmodulin, the distinct properties of CLP suggest that it has specific targets or targets that only partially overlap with those of calmodulin. Research has identified the unconventional myosin-10 (Myo10) as a specific target of CALML3. The discovery of Myo10 as a specific target of CALML3 is highly significant and suggests multiple lines of further research such as investigations of the Ca2+ regulation of Myo10 and the role of the loss of CLP in epithelial differentiation, adhesion, and cancer. Cells expressing CALML3 displayed a striking increase in the number and length of myosin-10-positive filopodia and showed increased mobility in a wound healing assay.

참고자료
  • Bennett RD, et al. (2007) Calmodulin-like protein increases filopodia-dependent cell motility via up-regulation of myosin-10. J Biol Chem. 282(5): 3205-12.
  • Perochon A, et al. (2011) Calmodulin and calmodulin-like proteins in plant calcium signaling. Biochimie. 93(12): 2048-53.
  • Chinpongpanich A, et al. (2011) Biophysical characterization of calmodulin and calmodulin-like proteins from rice, Oryza sativa L. Acta Biochim Biophys Sin (Shanghai). 43(11): 867-76.
  • Contact Us
    이미지
    • Human CALML3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".