휴먼 IL8Rb/CXCR2 Gene ORF cDNA clone expression plasmid, C-His 태그

  • Human CXCR2 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
데이터시트리뷰관련제품프로토콜
휴먼 IL8Rb/CXCR2 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001557.2
cDNA 크기:1083bp
cDNA 설명:Full length Clone DNA of interleukin 8 receptor, beta with His tag.
유전자 동의어:CD182, CXCR2, IL8R2, IL8RA, CMKAR2, CDw128b
:Human
벡터:pCMV/hygro-His
Plasmid:pCMV-CXCR2-10his
제한 사이트:KpnI + XhoI (5.5kb + 1.11kb)
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CXCR2 qPCR primers for gene expression analysis, HP100702 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
휴먼 IL8Rb/CXCR2 Gene Plasmid Map
Human CXCR2 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".