ARP1/ACTR1A cDNA ORF Clone, Canine, C-His tag

Cat: DG70196-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ARP1/ACTR1A Reagents

CRO Services

Product recommended


All ARP1/ACTR1A Reagents

ARP1/ACTR1A cDNA ORF Clone, Canine, C-His tag General Information

Gene

Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1131 bp
Description
Full length Clone DNA of Canine ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARP1/ACTR1A Background Information

Full Name
ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)

ARP1/ACTR1A cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
ARP1/ACTR1A cDNA ORF Clone in Cloning Vector, Canine DG70196-U
ARP1/ACTR1A cDNA ORF Clone, Canine, untagged DG70196-UT
ARP1/ACTR1A cDNA ORF Clone, Canine, C-GFPSpark® tag DG70196-ACG
ARP1/ACTR1A Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70196-ACGLN
ARP1/ACTR1A cDNA ORF Clone, Canine, N-GFPSpark® tag DG70196-ANG
ARP1/ACTR1A cDNA ORF Clone, Canine, C-OFPSpark® tag DG70196-ACR
ARP1/ACTR1A cDNA ORF Clone, Canine, N-OFPSpark® tag DG70196-ANR
ARP1/ACTR1A cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70196-CF
ARP1/ACTR1A cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70196-NF
ARP1/ACTR1A cDNA ORF Clone, Canine, N-His tag DG70196-NH
ARP1/ACTR1A cDNA ORF Clone, Canine, C-HA tag DG70196-CY
ARP1/ACTR1A cDNA ORF Clone, Canine, N-HA tag DG70196-NY
ARP1/ACTR1A cDNA ORF Clone, Canine, C-Myc tag DG70196-CM
ARP1/ACTR1A cDNA ORF Clone, Canine, N-Myc tag DG70196-NM

ARP1/ACTR1A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ARP1/ACTR1A cDNA ORF Clone in Cloning Vector, Rat RG81396-G

ARP1/ACTR1A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARP1/ACTR1A cDNA ORF Clone in Cloning Vector, Mouse MG52878-G
ARP1/ACTR1A cDNA ORF Clone, Mouse, untagged MG52878-UT
ARP1/ACTR1A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52878-ACG
ARP1/ACTR1A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52878-ACGLN
ARP1/ACTR1A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52878-ANG
ARP1/ACTR1A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52878-ACR
ARP1/ACTR1A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52878-ANR
ARP1/ACTR1A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52878-CF
ARP1/ACTR1A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52878-NF
ARP1/ACTR1A cDNA ORF Clone, Mouse, C-His tag MG52878-CH
ARP1/ACTR1A cDNA ORF Clone, Mouse, N-His tag MG52878-NH
ARP1/ACTR1A cDNA ORF Clone, Mouse, C-HA tag MG52878-CY
ARP1/ACTR1A cDNA ORF Clone, Mouse, N-HA tag MG52878-NY
ARP1/ACTR1A cDNA ORF Clone, Mouse, C-Myc tag MG52878-CM
ARP1/ACTR1A cDNA ORF Clone, Mouse, N-Myc tag MG52878-NM

ARP1/ACTR1A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARP1/ACTR1A cDNA ORF Clone in Cloning Vector, Human HG14111-G
ARP1/ACTR1A cDNA ORF Clone, Human, untagged HG14111-UT
ARP1/ACTR1A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14111-ACGLN
ARP1/ACTR1A cDNA ORF Clone, Human, C-GFPSpark® tag HG14111-ACG
ARP1/ACTR1A cDNA ORF Clone, Human, N-GFPSpark® tag HG14111-ANG
ARP1/ACTR1A cDNA ORF Clone, Human, C-OFPSpark® tag HG14111-ACR
ARP1/ACTR1A cDNA ORF Clone, Human, N-OFPSpark® tag HG14111-ANR
ARP1/ACTR1A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14111-CF
ARP1/ACTR1A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14111-NF
ARP1/ACTR1A cDNA ORF Clone, Human, C-His tag HG14111-CH
ARP1/ACTR1A cDNA ORF Clone, Human, N-His tag HG14111-NH
ARP1/ACTR1A cDNA ORF Clone, Human, C-HA tag HG14111-CY
ARP1/ACTR1A cDNA ORF Clone, Human, N-HA tag HG14111-NY
ARP1/ACTR1A cDNA ORF Clone, Human, C-Myc tag HG14111-CM
ARP1/ACTR1A cDNA ORF Clone, Human, N-Myc tag HG14111-NM
ARP1/ACTR1A qPCR Primer Pairs, Human HP102764
info info
添加购物车成功! 添加购物车失败!