Angiopoietin-2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70034-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Angiopoietin-2 Reagents
CRO Services
Product recommended

All Angiopoietin-2 Reagents
Angiopoietin-2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1488 bp
Description
Full length Clone DNA of Canine angiopoietin 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Angiopoietin-2 Background Information

Angiopoietin-2 (ANG 2, or ANGPT2), is a member of the ANG family, which plays an important role in angiogenesis during the development and growth of human cancers. Both ANGPT-1 and ANGPT-2 appear to bind to the tyrosine kinase receptor, Tie-2, found primarily on the luminal surface of endothelial cells. ANG-2's role in angiogenesis generally is considered as an antagonist for ANG1, inhibiting ANG1-promoted Tie2 signaling, which is critical for blood vessel maturation and stabilization. ANG-2 modulates angiogenesis in a cooperative manner with another important angiogenic factor, vascular endothelial growth factor A. Genetic studies have revealed that ANG-2 also is critical in lymphangiogenesis during development. ANG-2 has multiple physiologic effects that regulate vascular tone, hormone secretion, tissue growth and neural activity. Several reports indicate that ANG-2 can induce neovascularization in experimental systems due to the expression of different growth factors such as angiopoietin 2, vascular endothelial factor, and its receptor, fibroblast growth factor, platelet derived growth factor, transforming growth factor beta and epidermal growth factor. In addition, ANG-2 is strongly expressed in the vasculature of many tumors and it has been suggested that ANG-2 may act synergistically with other cytokines such as vascular endothelial growth factor to promote tumor-associated Angiogenesis and tumor progression.

Full Name
angiopoietin 2
References
  • Thomas M, et al. (2009) The role of the Angiopoietins in vascular morphogenesis. Angiogenesis. 12(2): 125-37.
  • Hu B, et al. (2009) Angiopoietin-2: development of inhibitors for cancer therapy. Curr Oncol Rep. 11(2): 111-6.
  • Fiedler U, et al. (2006) Angiopoietins: a link between angiogenesis and inflammation. Trends Immunol. 27: 552-8.
  • Escobar E, et al. (2004) Angiotensin II, cell proliferation and angiogenesis regulator: biologic and therapeutic implications in cancer. Curr Vasc Pharmacol. 2(4): 385-99.
  • Angiopoietin-2 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    Angiopoietin-2 cDNA ORF Clone in Cloning Vector, Canine DG70034-G
    Angiopoietin-2 cDNA ORF Clone, Canine, untagged DG70034-UT
    Angiopoietin-2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70034-ACG
    Angiopoietin-2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70034-ACGLN
    Angiopoietin-2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70034-ACR
    Angiopoietin-2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70034-NF
    Angiopoietin-2 cDNA ORF Clone, Canine, C-His tag DG70034-CH
    Angiopoietin-2 cDNA ORF Clone, Canine, N-His tag DG70034-NH
    Angiopoietin-2 cDNA ORF Clone, Canine, C-HA tag DG70034-CY
    Angiopoietin-2 cDNA ORF Clone, Canine, N-HA tag DG70034-NY
    Angiopoietin-2 cDNA ORF Clone, Canine, C-Myc tag DG70034-CM
    Angiopoietin-2 cDNA ORF Clone, Canine, N-Myc tag DG70034-NM

    Angiopoietin-2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Angiopoietin-2 cDNA ORF Clone in Cloning Vector, Rhesus CG90026-G
    Angiopoietin-2 cDNA ORF Clone, Rhesus, untagged CG90026-UT
    Angiopoietin-2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90026-ACGLN
    Angiopoietin-2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90026-ACG
    Angiopoietin-2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90026-ACR
    Angiopoietin-2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90026-CF
    Angiopoietin-2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90026-NF
    Angiopoietin-2 cDNA ORF Clone, Rhesus, C-His tag CG90026-CH
    Angiopoietin-2 cDNA ORF Clone, Rhesus, N-His tag CG90026-NH
    Angiopoietin-2 cDNA ORF Clone, Rhesus, C-HA tag CG90026-CY
    Angiopoietin-2 cDNA ORF Clone, Rhesus, N-HA tag CG90026-NY
    Angiopoietin-2 cDNA ORF Clone, Rhesus, C-Myc tag CG90026-CM
    Angiopoietin-2 cDNA ORF Clone, Rhesus, N-Myc tag CG90026-NM

    Angiopoietin-2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Angiopoietin-2 cDNA ORF Clone in Cloning Vector, Rat RG81071-G

    Angiopoietin-2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Angiopoietin-2 cDNA ORF Clone in Cloning Vector, Mouse MG50298-M
    Angiopoietin-2 cDNA ORF Clone, Mouse, untagged MG50298-UT
    Angiopoietin-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50298-ACGLN
    Angiopoietin-2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50298-ACG
    Angiopoietin-2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50298-ACR
    Angiopoietin-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50298-CF
    Angiopoietin-2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50298-NF
    Angiopoietin-2 cDNA ORF Clone, Mouse, C-His tag MG50298-CH
    Angiopoietin-2 cDNA ORF Clone, Mouse, N-His tag MG50298-NH
    Angiopoietin-2 cDNA ORF Clone, Mouse, C-HA tag MG50298-CY
    Angiopoietin-2 cDNA ORF Clone, Mouse, N-HA tag MG50298-NY
    Angiopoietin-2 cDNA ORF Clone, Mouse, C-Myc tag MG50298-CM
    Angiopoietin-2 cDNA ORF Clone, Mouse, N-Myc tag MG50298-NM
    Angiopoietin-2 qPCR Primer Pairs, Mouse MP200321

    Angiopoietin-2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Angiopoietin-2 cDNA ORF Clone in Cloning Vector, Human HG10691-G
    Angiopoietin-2 cDNA ORF Clone, Human, untagged HG10691-UT
    Angiopoietin-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10691-ACG
    Angiopoietin-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10691-ACGLN
    Angiopoietin-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10691-ACR
    Angiopoietin-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10691-CF
    Angiopoietin-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10691-NF
    Angiopoietin-2 cDNA ORF Clone, Human, C-His tag HG10691-CH
    Angiopoietin-2 cDNA ORF Clone, Human, N-His tag HG10691-NH
    Angiopoietin-2 cDNA ORF Clone, Human, C-HA tag HG10691-CY
    Angiopoietin-2 cDNA ORF Clone, Human, N-HA tag HG10691-NY
    Angiopoietin-2 cDNA ORF Clone, Human, C-Myc tag HG10691-CM
    Angiopoietin-2 cDNA ORF Clone, Human, N-Myc tag HG10691-NM
    Angiopoietin-2 qPCR Primer Pairs, Human HP100880
    info info
    添加购物车成功! 添加购物车失败!