calmodulin 3/CALM3 cDNA ORF Clone, Canine, C-His tag

Cat: DG70242-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All calmodulin 3/CALM3 Reagents
CRO Services
Product recommended

All calmodulin 3/CALM3 Reagents
calmodulin 3/CALM3 cDNA ORF Clone, Canine, C-His tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
450 bp
Description
Full length Clone DNA of Canine calmodulin 3 (phosphorylase kinase, delta) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

calmodulin 3/CALM3 Background Information
Full Name
calmodulin 3 (phosphorylase kinase, delta)

calmodulin 3/CALM3 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
calmodulin 3/CALM3 cDNA ORF Clone in Cloning Vector, Canine DG70242-U
calmodulin 3/CALM3 cDNA ORF Clone, Canine, untagged DG70242-UT
calmodulin 3/CALM3 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70242-ACG
calmodulin 3/CALM3 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70242-ACGLN
calmodulin 3/CALM3 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70242-ANG
calmodulin 3/CALM3 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70242-ACR
calmodulin 3/CALM3 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70242-ANR
calmodulin 3/CALM3 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70242-CF
calmodulin 3/CALM3 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70242-NF
calmodulin 3/CALM3 cDNA ORF Clone, Canine, C-HA tag DG70242-CY
calmodulin 3/CALM3 cDNA ORF Clone, Canine, N-HA tag DG70242-NY
calmodulin 3/CALM3 cDNA ORF Clone, Canine, C-Myc tag DG70242-CM
calmodulin 3/CALM3 cDNA ORF Clone, Canine, N-Myc tag DG70242-NM

calmodulin 3/CALM3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
calmodulin 3/CALM3 cDNA ORF Clone in Cloning Vector, Mouse MG51559-U
calmodulin 3/CALM3 cDNA ORF Clone, Mouse, untagged MG51559-UT
calmodulin 3/CALM3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51559-ACG
calmodulin 3/CALM3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51559-ACGLN
calmodulin 3/CALM3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51559-ANG
calmodulin 3/CALM3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51559-ACR
calmodulin 3/CALM3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51559-ANR
calmodulin 3/CALM3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51559-CF
calmodulin 3/CALM3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51559-NF
calmodulin 3/CALM3 cDNA ORF Clone, Mouse, C-His tag MG51559-CH
calmodulin 3/CALM3 cDNA ORF Clone, Mouse, N-His tag MG51559-NH
calmodulin 3/CALM3 cDNA ORF Clone, Mouse, C-HA tag MG51559-CY
calmodulin 3/CALM3 cDNA ORF Clone, Mouse, N-HA tag MG51559-NY
calmodulin 3/CALM3 cDNA ORF Clone, Mouse, C-Myc tag MG51559-CM
calmodulin 3/CALM3 cDNA ORF Clone, Mouse, N-Myc tag MG51559-NM
calmodulin 3/CALM3 qPCR Primer Pairs, Mouse MP201442

calmodulin 3/CALM3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
calmodulin 3/CALM3 cDNA ORF Clone in Cloning Vector, Human HG16723-U
calmodulin 3/CALM3 cDNA ORF Clone, Human, untagged HG16723-UT
calmodulin 3/CALM3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16723-ACG
calmodulin 3/CALM3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16723-ACGLN
calmodulin 3/CALM3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16723-ANG
calmodulin 3/CALM3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16723-ACR
calmodulin 3/CALM3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16723-ANR
calmodulin 3/CALM3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16723-CF
calmodulin 3/CALM3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16723-NF
calmodulin 3/CALM3 cDNA ORF Clone, Human, C-His tag HG16723-CH
calmodulin 3/CALM3 cDNA ORF Clone, Human, N-His tag HG16723-NH
calmodulin 3/CALM3 cDNA ORF Clone, Human, C-HA tag HG16723-CY
calmodulin 3/CALM3 cDNA ORF Clone, Human, N-HA tag HG16723-NY
calmodulin 3/CALM3 cDNA ORF Clone, Human, C-Myc tag HG16723-CM
calmodulin 3/CALM3 cDNA ORF Clone, Human, N-Myc tag HG16723-NM
info info
添加购物车成功! 添加购物车失败!