CHN1 cDNA ORF Clone, Canine, C-His tag

Cat: DG70211-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CHN1 Reagents
CRO Services
Product recommended

All CHN1 Reagents
CHN1 cDNA ORF Clone, Canine, C-His tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1005 bp
Description
Full length Clone DNA of Canine chimerin 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHN1 Background Information

CHN1, also known as chimerin 1, is a TPase-activating protein for ras-related p21-rac and a phorbol ester receptor. It is predominantly expressed in neurons, and plays an important role in neuronal signal-transduction mechanisms. CHN1 is involved in the assembly of neuronal locomotor circuits as a direct effector of EPHA4 in axon guidance. The CHN1 gene provides instructions for making two very similar proteins called α1-chimaerin and α2-chimaerin. These proteins play an important role in the early development of the nervous system. In particular, they help regulate complex chemical signaling pathways during the formation and development of nerve cells (neurons). These proteins help guide the growth of axons and dendrites, which are specialized extensions of neurons that transmit and receive nerve impulses throughout the nervous system.

Full Name
chimerin 1
References
  • Miyake N. et al, 2010, Am J Med Genet A. 152 (1): 215-7.
  • Miyake N. et al., 2011, Invest Ophthalmol Vis Sci. 52 (9): 6321-8.
  • Volk AE. et al., 2010, Graefes Arch Clin Exp Ophthalmol. 248 (9): 1351-7.
  • CHN1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    CHN1 cDNA ORF Clone in Cloning Vector, Canine DG70211-U
    CHN1 cDNA ORF Clone, Canine, untagged DG70211-UT
    CHN1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70211-ACG
    CHN1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70211-ACGLN
    CHN1 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70211-ANG
    CHN1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70211-ACR
    CHN1 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70211-ANR
    CHN1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70211-CF
    CHN1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70211-NF
    CHN1 cDNA ORF Clone, Canine, N-His tag DG70211-NH
    CHN1 cDNA ORF Clone, Canine, C-HA tag DG70211-CY
    CHN1 cDNA ORF Clone, Canine, N-HA tag DG70211-NY
    CHN1 cDNA ORF Clone, Canine, C-Myc tag DG70211-CM
    CHN1 cDNA ORF Clone, Canine, N-Myc tag DG70211-NM

    CHN1 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    CHN1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90836-G
    CHN1 cDNA ORF Clone, Cynomolgus, untagged CG90836-UT
    CHN1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90836-ACG
    CHN1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90836-ACGLN
    CHN1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90836-ANG
    CHN1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90836-ACR
    CHN1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90836-ANR
    CHN1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90836-CF
    CHN1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90836-NF
    CHN1 cDNA ORF Clone, Cynomolgus, C-His tag CG90836-CH
    CHN1 cDNA ORF Clone, Cynomolgus, N-His tag CG90836-NH
    CHN1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90836-CY
    CHN1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90836-NY
    CHN1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90836-CM
    CHN1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90836-NM

    CHN1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CHN1 cDNA ORF Clone in Cloning Vector, Human HG14914-G
    CHN1 cDNA ORF Clone, Human, untagged HG14914-UT
    CHN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14914-ACGLN
    CHN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14914-ACG
    CHN1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14914-ANG
    CHN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14914-ACR
    CHN1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14914-ANR
    CHN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14914-CF
    CHN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14914-NF
    CHN1 cDNA ORF Clone, Human, C-His tag HG14914-CH
    CHN1 cDNA ORF Clone, Human, N-His tag HG14914-NH
    CHN1 cDNA ORF Clone, Human, C-HA tag HG14914-CY
    CHN1 cDNA ORF Clone, Human, N-HA tag HG14914-NY
    CHN1 cDNA ORF Clone, Human, C-Myc tag HG14914-CM
    CHN1 cDNA ORF Clone, Human, N-Myc tag HG14914-NM
    CHN1 qPCR Primer Pairs, Human HP103543
    info info
    添加购物车成功! 添加购物车失败!