After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

Canine CLU ORF mammalian expression plasmid, C-His tag

데이터시트리뷰관련제품프로토콜
Canine CLU cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001003370.1
cDNA 크기:1338bp
cDNA 설명:Full length Clone DNA of Canis lupus familiaris clusterin with C terminal His tag.
유전자 동의어:GP80
:Canine
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
연구배경

Clusterin, also known as complement-associated protein SP-40, Complement cytolysis inhibitor, Apolipoprotein J, Testosterone-repressed prostate message 2, Aging-associated gene 4 protein, CLU and APOJ, is a secreted protein which belongs to the clusterin family. Clusterin/Apolipoprotein J/Apo-J is an enigmatic glycoprotein with a nearly ubiquitous tissue distribution and an apparent involvement in biological processes ranging from mammary gland involution to neurodegeneration in Alzheimer's disease. Its major form, a heterodimer, is secreted and present in physiological fluids, but truncated forms targeted to the nucleus have also been identified. Clusterin/Apolipoprotein J/Apo-J is a widely distributed glycoprotein with a wide range of biologic properties. A prominent and defining feature of clusterin is its marked induction in such disease states as glomerulonephritis, cystic renal disease, renal tubular injury, neurodegenerative conditions, atherosclerosis, and myocardial infarction. Upregulation of clusterin mRNA and protein levels detected in diverse disease states and in in vitro systems have led to suggestions that it functions in membrane lipid recycling, in apoptotic cell death, and as a stress-induced secreted chaperone protein, amongst others.

참고자료
  • Silkensen JR, et al. (1994) The role of clusterin in tissue injury. Biochem Cell Biol. 72(11-12): 483-8.
  • Naik RR, et al. (2002) Biomimetic synthesis and patterning of silver nanoparticles. Nat Mater. 1(3): 169-72.
  • Djeu JY, et al. (2009) Clusterin and chemoresistance. Adv Cancer Res. 105: 77-92.
  • Size / Price
    Cat No: DG70207-CH
    정가:   (Save )
    가격:      [How to order]
    재고정보
     배송안내
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".