DDX5 cDNA ORF Clone, Canine, C-HA tag

Cat: DG70237-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All DDX5 Reagents

CRO Services

Product recommended


All DDX5 Reagents

DDX5 cDNA ORF Clone, Canine, C-HA tag General Information

Gene

Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1845 bp
Description
Full length Clone DNA of Canine DEAD (Asp-Glu-Ala-Asp) box helicase 5 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DDX5 Background Information

Full Name
DEAD (Asp-Glu-Ala-Asp) box helicase 5

DDX5 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
DDX5 cDNA ORF Clone in Cloning Vector, Ferret FG60098-G
DDX5 cDNA ORF Clone, Ferret, untagged FG60098-UT
DDX5 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60098-ACG
DDX5 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60098-ACGLN
DDX5 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60098-ANG
DDX5 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60098-ACR
DDX5 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60098-ANR
DDX5 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60098-CF
DDX5 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60098-NF
DDX5 cDNA ORF Clone, Ferret, C-His tag FG60098-CH
DDX5 cDNA ORF Clone, Ferret, N-His tag FG60098-NH
DDX5 cDNA ORF Clone, Ferret, C-HA tag FG60098-CY
DDX5 cDNA ORF Clone, Ferret, N-HA tag FG60098-NY
DDX5 cDNA ORF Clone, Ferret, C-Myc tag FG60098-CM
DDX5 cDNA ORF Clone, Ferret, N-Myc tag FG60098-NM

DDX5 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
DDX5 cDNA ORF Clone in Cloning Vector, Canine DG70237-U
DDX5 cDNA ORF Clone, Canine, untagged DG70237-UT
DDX5 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70237-ACGLN
DDX5 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70237-ACG
DDX5 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70237-ANG
DDX5 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70237-ACR
DDX5 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70237-ANR
DDX5 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70237-CF
DDX5 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70237-NF
DDX5 cDNA ORF Clone, Canine, C-His tag DG70237-CH
DDX5 cDNA ORF Clone, Canine, N-His tag DG70237-NH
DDX5 cDNA ORF Clone, Canine, N-HA tag DG70237-NY
DDX5 cDNA ORF Clone, Canine, C-Myc tag DG70237-CM
DDX5 cDNA ORF Clone, Canine, N-Myc tag DG70237-NM

DDX5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DDX5 cDNA ORF Clone in Cloning Vector, Rat RG81401-G

DDX5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DDX5 cDNA ORF Clone in Cloning Vector, Human HG16175-G
DDX5 cDNA ORF Clone, Human, untagged HG16175-UT
DDX5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16175-ACGLN
DDX5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16175-ACG
DDX5 cDNA ORF Clone, Human, N-GFPSpark® tag HG16175-ANG
DDX5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16175-ACR
DDX5 cDNA ORF Clone, Human, N-OFPSpark® tag HG16175-ANR
DDX5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16175-CF
DDX5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16175-NF
DDX5 cDNA ORF Clone, Human, C-His tag HG16175-CH
DDX5 cDNA ORF Clone, Human, N-His tag HG16175-NH
DDX5 cDNA ORF Clone, Human, C-HA tag HG16175-CY
DDX5 cDNA ORF Clone, Human, N-HA tag HG16175-NY
DDX5 cDNA ORF Clone, Human, C-Myc tag HG16175-CM
DDX5 cDNA ORF Clone, Human, N-Myc tag HG16175-NM
DDX5 qPCR Primer Pairs, Human HP104944
info info
添加购物车成功! 添加购物车失败!