FGF21 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70038-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FGF21 Reagents
CRO Services
Product recommended

All FGF21 Reagents
FGF21 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
630 bp
Description
Full length Clone DNA of Canine fibroblast growth factor 21 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGF21 Background Information

Fibroblast growth factor 21 (FGF21) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF-21 has a hydrophobic amino terminus, which is a typical signal sequence, and appears to be a secreted protein. The metabolic regulator fibroblast growth factor 21 (FGF21) has antidiabetic properties in animal models of diabetes and obesity. FGF21 is a novel adipokine associated with obesity-related metabolic complications in humans. The paradoxical increase of serum FGF21 in obese individuals, which may be explained by a compensatory response or resistance to FGF21, warrants further investigation. FGF-21, which we have identified as a novel metabolic factor, exhibits the therapeutic characteristics necessary for an effective treatment of diabetes.

Full Name
fibroblast growth factor 21
References
  • Zhang X, et al. (2008) Serum FGF21 levels are increased in obesity and are independently associated with the metabolic syndrome in humans. Diabetes. 57(5): 1246-53.
  • Lundåsen T, et al. (2007) PPARalpha is a key regulator of hepatic FGF21. Biochem Biophys Res Commun. 360(2): 437-40.
  • Kharitonenkov A, et al. (2005) FGF-21 as a novel metabolic regulator. J Clin Invest. 115(6): 1627-35.
  • FGF21 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    FGF21 cDNA ORF Clone in Cloning Vector, Canine DG70038-G
    FGF21 cDNA ORF Clone, Canine, untagged DG70038-UT
    FGF21 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70038-ACG
    FGF21 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70038-ACGLN
    FGF21 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70038-ACR
    FGF21 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70038-NF
    FGF21 cDNA ORF Clone, Canine, C-His tag DG70038-CH
    FGF21 cDNA ORF Clone, Canine, N-His tag DG70038-NH
    FGF21 cDNA ORF Clone, Canine, C-HA tag DG70038-CY
    FGF21 cDNA ORF Clone, Canine, N-HA tag DG70038-NY
    FGF21 cDNA ORF Clone, Canine, C-Myc tag DG70038-CM
    FGF21 cDNA ORF Clone, Canine, N-Myc tag DG70038-NM

    FGF21 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FGF21 cDNA ORF Clone in Cloning Vector, Mouse MG50421-M
    FGF21 cDNA ORF Clone, Mouse, untagged MG50421-UT
    FGF21 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50421-ACG
    FGF21 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50421-ACGLN
    FGF21 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50421-ACR
    FGF21 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50421-CF
    FGF21 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50421-NF
    FGF21 cDNA ORF Clone, Mouse, C-His tag MG50421-CH
    FGF21 cDNA ORF Clone, Mouse, N-His tag MG50421-NH
    FGF21 cDNA ORF Clone, Mouse, C-HA tag MG50421-CY
    FGF21 cDNA ORF Clone, Mouse, N-HA tag MG50421-NY
    FGF21 cDNA ORF Clone, Mouse, C-Myc tag MG50421-CM
    FGF21 cDNA ORF Clone, Mouse, N-Myc tag MG50421-NM
    FGF21 qPCR Primer Pairs, Mouse MP200433

    FGF21 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FGF21 cDNA ORF Clone in Cloning Vector, Human HG10911-M
    FGF21 cDNA ORF Clone, Human, untagged HG10911-UT
    FGF21 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10911-ACGLN
    FGF21 cDNA ORF Clone, Human, C-GFPSpark® tag HG10911-ACG
    FGF21 cDNA ORF Clone, Human, C-OFPSpark® tag HG10911-ACR
    FGF21 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10911-CF
    FGF21 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10911-NF
    FGF21 cDNA ORF Clone, Human, C-His tag HG10911-CH
    FGF21 cDNA ORF Clone, Human, N-His tag HG10911-NH
    FGF21 cDNA ORF Clone, Human, C-HA tag HG10911-CY
    FGF21 cDNA ORF Clone, Human, N-HA tag HG10911-NY
    FGF21 cDNA ORF Clone, Human, C-Myc tag HG10911-CM
    FGF21 cDNA ORF Clone, Human, N-Myc tag HG10911-NM
    FGF21 qPCR Primer Pairs, Human HP100794
    info info
    添加购物车成功! 添加购物车失败!