Text Size:AAA

개 GATE-16 / GABARAPL2 Gene ORF cDNA clone expression plasmid, C-His 태그

    데이터시트리뷰관련제품프로토콜
     GABARAPL2 cDNA 클론 제품 정보
    Gene_bank_ref_id:XM_005620674.1
    cDNA 크기:354bp
    cDNA 설명:Full length Clone DNA of Canis lupus familiaris GABA(A) receptor-associated protein-like 2 with C terminal His tag.
    유전자 동의어:GABARAPL2
    :Canine
    벡터:pCMV3-C-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    연구배경

    GATE-16, also known as ATG8, belongs to the MAP1 LC3 family. It is expressed at high levels in the brain, heart, prostate, ovary, spleen and skeletal muscle. GATE-16 is expressed at very low levels in lung, thymus and small intestine. GATE-16 is involved in intra-Golgi traffic. It modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1.

    참고자료
  • Ewing Rob M, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Okazaki N, et al. (2000) Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation. Brain Res Mol Brain Res. 85(1-2):1-12.
  • Xin Y, et al. (2001) Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein. Genomics. 74 (3):408-13.
  • Size / Price
    Cat No: DG70191-CH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".