IL2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70014-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All IL2 Reagents

CRO Services

Product recommended


All IL2 Reagents

IL2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information

Gene

Species
Canine
NCBI Ref Seq
RefSeq ORF Size
468 bp
Description
Full length Clone DNA of Canine interleukin 2 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL2 Background Information

Interleukin-2, also known as T-cell growth factor, TCGF, Aldesleukin and IL2, is a secreted protein which belongs to the IL-2 family. Interleukin-2 / IL-2 was the first interleukin molecule to be discovered. Interleukin-2 / IL-2 molecule was first purified to homogeneity by immunoaffinity chromatography by Kendall Smith and his team at Dartmouth Medical School. Interleukin-2 / IL-2 was also the first cytokine shown to mediate its effects via a specific IL-2 receptor, and it was also the first interleukin to be cloned and expressed from a complementary DNA (cDNA) library. Interleukin-2 / IL-2 was designated number 2 because Smith's data at the time indicated that IL-1, produced by macrophages, facilitates IL-2 production by T lymphocytes (T cells).
Interleukin-2 / IL-2 is produced by T-cells in response to antigenic or mitogenic stimulation, this protein is required for T-cell proliferation and other activities crucial to regulation of the immune response. Interleukin-2 / IL-2 is normally produced by the body during an immune response. When environmental substances (molecules or microbes) gain access to the body, these substances (termed antigens) are recognized as foreign by antigen receptors that are expressed on the surface of lymphocytes. Antigen binding to the T cell receptor (TCR) stimulates the secretion of Interleukin-2 / IL-2, and the expression of IL-2 receptors IL-2R. The IL-2 / IL-2R interaction then stimulates the growth, differentiation and survival of antigen-selected cytotoxic T cells via the activation of the expression of specific genes. Interleukin-2 / IL-2 can stimulate B-cells, monocytes, lymphokine-activated killer cells, natural killer cells, and glioma cells. The World Reference Standard for Interleukin-2 / IL-2 is produced by the National Institute of Biological Standards and Control in the UK. A recombinant form of Interleukin-2 / IL-2 for clinical use is manufactured by Chiron Corporation with the brand name Proleukin. It has been approved by the Food and Drug Administration (FDA) for the treatment of cancers (malignant melanoma, renal cell cancer), and is in clinical trials for the treatment of chronic viral infections, and as a booster (adjuvant) for vaccines. The use of Interleukin-2 / IL-2 in HIV therapy has been found to be ineffective.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
interleukin 2
References
  • Smith KA, et al.,1980,  J. Exp. Med.151 (6): 1551-6. 
  • Smith KA, et al.,1980, Nature. 287 (5785): 853-5.
  • Taniguchi T, et al.,1983, Nature. 302 (5906): 305.
  • Cantrell DA, et al.,1984, Science. 224 (4655): 1312-6. 
  • Smith KA, et al.,1988, Science. 240 (4856): 1169-76.
  • Wang X. et al., 2005, Science 310:1159-63.
  • Stauber D.J. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 2788-93.
  • IL2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL2 cDNA ORF Clone in Cloning Vector, Rhesus CG90321-G
    IL2 cDNA ORF Clone, Rhesus, untagged CG90321-UT
    IL2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90321-ACGLN
    IL2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90321-ACG
    IL2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90321-ACR
    IL2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90321-CF
    IL2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90321-NF
    IL2 cDNA ORF Clone, Rhesus, C-His tag CG90321-CH
    IL2 cDNA ORF Clone, Rhesus, N-His tag CG90321-NH
    IL2 cDNA ORF Clone, Rhesus, C-HA tag CG90321-CY
    IL2 cDNA ORF Clone, Rhesus, N-HA tag CG90321-NY
    IL2 cDNA ORF Clone, Rhesus, C-Myc tag CG90321-CM
    IL2 cDNA ORF Clone, Rhesus, N-Myc tag CG90321-NM

    IL2 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL2 cDNA ORF Clone in Cloning Vector, Canine DG70014-G
    IL2 cDNA ORF Clone, Canine, untagged DG70014-UT
    IL2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70014-ACGLN
    IL2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70014-ACG
    IL2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70014-ACR
    IL2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70014-NF
    IL2 cDNA ORF Clone, Canine, C-His tag DG70014-CH
    IL2 cDNA ORF Clone, Canine, N-His tag DG70014-NH
    IL2 cDNA ORF Clone, Canine, C-HA tag DG70014-CY
    IL2 cDNA ORF Clone, Canine, N-HA tag DG70014-NY
    IL2 cDNA ORF Clone, Canine, C-Myc tag DG70014-CM
    IL2 cDNA ORF Clone, Canine, N-Myc tag DG70014-NM

    IL2 cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    IL2 cDNA ORF Clone in Cloning Vector, Rabbit TG65005-G
    IL2 cDNA ORF Clone, Rabbit, untagged TG65005-UT
    IL2 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65005-ACGLN
    IL2 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65005-ACG
    IL2 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65005-ACR
    IL2 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65005-CF
    IL2 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65005-NF
    IL2 cDNA ORF Clone, Rabbit, C-His tag TG65005-CH
    IL2 cDNA ORF Clone, Rabbit, N-His tag TG65005-NH
    IL2 cDNA ORF Clone, Rabbit, C-HA tag TG65005-CY
    IL2 cDNA ORF Clone, Rabbit, N-HA tag TG65005-NY
    IL2 cDNA ORF Clone, Rabbit, C-Myc tag TG65005-CM
    IL2 cDNA ORF Clone, Rabbit, N-Myc tag TG65005-NM

    IL2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL2 cDNA ORF Clone in Cloning Vector, Rat RG80075-M
    IL2 cDNA ORF Clone, Rat, untagged RG80075-UT
    IL2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80075-ACGLN
    IL2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80075-ACG
    IL2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80075-ACR
    IL2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80075-CF
    IL2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80075-NF
    IL2 cDNA ORF Clone, Rat, C-His tag RG80075-CH
    IL2 cDNA ORF Clone, Rat, N-His tag RG80075-NH
    IL2 cDNA ORF Clone, Rat, C-HA tag RG80075-CY
    IL2 cDNA ORF Clone, Rat, N-HA tag RG80075-NY
    IL2 cDNA ORF Clone, Rat, C-Myc tag RG80075-CM
    IL2 cDNA ORF Clone, Rat, N-Myc tag RG80075-NM
    IL2 qPCR Primer Pairs, Rat RP300071

    IL2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL2 cDNA ORF Clone in Cloning Vector, Mouse MG51061-G
    IL2 cDNA ORF Clone, Mouse, untagged MG51061-UT
    IL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51061-ACG
    IL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51061-ACGLN
    IL2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51061-ACR
    IL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51061-CF
    IL2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51061-NF
    IL2 cDNA ORF Clone, Mouse, C-His tag MG51061-CH
    IL2 cDNA ORF Clone, Mouse, N-His tag MG51061-NH
    IL2 cDNA ORF Clone, Mouse, C-HA tag MG51061-CY
    IL2 cDNA ORF Clone, Mouse, N-HA tag MG51061-NY
    IL2 cDNA ORF Clone, Mouse, C-Myc tag MG51061-CM
    IL2 cDNA ORF Clone, Mouse, N-Myc tag MG51061-NM
    IL2 qPCR Primer Pairs, Mouse MP201017

    IL2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL2 cDNA ORF Clone in Cloning Vector, Human HG11848-G
    IL2 cDNA ORF Clone, Human, untagged HG11848-UT
    IL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11848-ACG
    IL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11848-ACGLN
    IL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11848-ACR
    IL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11848-CF
    IL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11848-NF
    IL2 cDNA ORF Clone, Human, C-His tag HG11848-CH
    IL2 cDNA ORF Clone, Human, N-His tag HG11848-NH
    IL2 cDNA ORF Clone, Human, C-HA tag HG11848-CY
    IL2 cDNA ORF Clone, Human, N-HA tag HG11848-NY
    IL2 cDNA ORF Clone, Human, C-Myc tag HG11848-CM
    IL2 cDNA ORF Clone, Human, N-Myc tag HG11848-NM
    IL2 qPCR Primer Pairs, Human HP101763
    info info
    添加购物车成功! 添加购物车失败!