LC3B cDNA ORF Clone, Canine, C-His tag

Cat: DG70200-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All LC3B Reagents

CRO Services

Product recommended


All LC3B Reagents

LC3B cDNA ORF Clone, Canine, C-His tag General Information

Gene

Species
Canine
NCBI Ref Seq
RefSeq ORF Size
378 bp
Description
Full length Clone DNA of Canine microtubule-associated protein 1 light chain 3 beta with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LC3B Background Information

LC3B, also known as MAP1LC3B, is a member of the MAP1 LC3 family. It is moat abundantly expressed in heart, brain, skeletal muscle and testis. LC3B is a subunit of neuronal microtubule and functions in formation of autophagosomal vacuoles (autophagosomes). It associated MAP1A and MAP1B proteins, which are involved in microtubule assembly and important for neurogenesis. LC3B also plays a role in autophagy, a process that involves the bulk degradation of cytoplasmic component.

Full Name
microtubule-associated protein 1 light chain 3 beta
References
  • Behrends C. et al., 2010, Nature. 466 (7302): 68-76.
  • Tanida I. et al., 2005, Int J Biochem Cell Biol. 36 (12): 2503-18.
  • Kabeya Y. et al., 2000, EMBO J. 19 (21): 5720-8.
  • Cherra SJ. et al., 2010, J Cell Biol. 190 (4): 533-9.
  • LC3B cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    LC3B cDNA ORF Clone in Cloning Vector, Canine DG70200-U
    LC3B cDNA ORF Clone, Canine, untagged DG70200-UT
    LC3B Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70200-ACGLN
    LC3B cDNA ORF Clone, Canine, C-GFPSpark® tag DG70200-ACG
    LC3B cDNA ORF Clone, Canine, N-GFPSpark® tag DG70200-ANG
    LC3B cDNA ORF Clone, Canine, C-OFPSpark® tag DG70200-ACR
    LC3B cDNA ORF Clone, Canine, N-OFPSpark® tag DG70200-ANR
    LC3B cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70200-CF
    LC3B cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70200-NF
    LC3B cDNA ORF Clone, Canine, N-His tag DG70200-NH
    LC3B cDNA ORF Clone, Canine, C-HA tag DG70200-CY
    LC3B cDNA ORF Clone, Canine, N-HA tag DG70200-NY
    LC3B cDNA ORF Clone, Canine, C-Myc tag DG70200-CM
    LC3B cDNA ORF Clone, Canine, N-Myc tag DG70200-NM

    LC3B cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    LC3B cDNA ORF Clone in Cloning Vector, Rat RG80635-U
    LC3B cDNA ORF Clone, Rat, untagged RG80635-UT
    LC3B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80635-ACGLN
    LC3B cDNA ORF Clone, Rat, C-GFPSpark® tag RG80635-ACG
    LC3B cDNA ORF Clone, Rat, N-GFPSpark® tag RG80635-ANG
    LC3B cDNA ORF Clone, Rat, C-OFPSpark® tag RG80635-ACR
    LC3B cDNA ORF Clone, Rat, N-OFPSpark® tag RG80635-ANR
    LC3B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80635-CF
    LC3B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80635-NF
    LC3B cDNA ORF Clone, Rat, C-His tag RG80635-CH
    LC3B cDNA ORF Clone, Rat, N-His tag RG80635-NH
    LC3B cDNA ORF Clone, Rat, C-HA tag RG80635-CY
    LC3B cDNA ORF Clone, Rat, N-HA tag RG80635-NY
    LC3B cDNA ORF Clone, Rat, C-Myc tag RG80635-CM
    LC3B cDNA ORF Clone, Rat, N-Myc tag RG80635-NM
    LC3B qPCR Primer Pairs, Rat RP300599

    LC3B cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    LC3B cDNA ORF Clone in Cloning Vector, Mouse MG52515-U
    LC3B cDNA ORF Clone, Mouse, untagged MG52515-UT
    LC3B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52515-ACGLN
    LC3B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52515-ACG
    LC3B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52515-ANG
    LC3B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52515-ACR
    LC3B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52515-ANR
    LC3B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52515-CF
    LC3B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52515-NF
    LC3B cDNA ORF Clone, Mouse, C-His tag MG52515-CH
    LC3B cDNA ORF Clone, Mouse, N-His tag MG52515-NH
    LC3B cDNA ORF Clone, Mouse, C-HA tag MG52515-CY
    LC3B cDNA ORF Clone, Mouse, N-HA tag MG52515-NY
    LC3B cDNA ORF Clone, Mouse, C-Myc tag MG52515-CM
    LC3B cDNA ORF Clone, Mouse, N-Myc tag MG52515-NM
    LC3B qPCR Primer Pairs, Mouse MP202388

    LC3B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LC3B cDNA ORF Clone in Cloning Vector, Human HG14555-U
    LC3B cDNA ORF Clone, Human, untagged HG14555-UT
    LC3B cDNA ORF Clone, Human, C-GFPSpark® tag HG14555-ACG
    LC3B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14555-ACGLN
    LC3B cDNA ORF Clone, Human, N-GFPSpark® tag HG14555-ANG
    LC3B cDNA ORF Clone, Human, C-OFPSpark® tag HG14555-ACR
    LC3B cDNA ORF Clone, Human, N-OFPSpark® tag HG14555-ANR
    LC3B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14555-CF
    LC3B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14555-NF
    LC3B cDNA ORF Clone, Human, C-His tag HG14555-CH
    LC3B cDNA ORF Clone, Human, N-His tag HG14555-NH
    LC3B cDNA ORF Clone, Human, C-HA tag HG14555-CY
    LC3B cDNA ORF Clone, Human, N-HA tag HG14555-NY
    LC3B cDNA ORF Clone, Human, C-Myc tag HG14555-CM
    LC3B cDNA ORF Clone, Human, N-Myc tag HG14555-NM
    info info
    添加购物车成功! 添加购物车失败!