BCRP / ABCG2 cDNA ORF Clone, Rhesus, N-His tag

1/1
Price:
Size:
Number:

BCRP / ABCG2 cDNA ORF Clone, Rhesus, N-His tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
2010 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus ATP-binding cassette, sub-family G (WHITE), member 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+2.01kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BCRP / ABCG2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BCRP / ABCG2 cDNA ORF Clone, Rhesus, N-His tag: Validated Images

BCRP / ABCG2 Background Information

ATP-binding cassette subfamily G member 2 (ABCG2), a member of the ABC transporter superfamily proteins. the expression of ABCG2 is related to tumorigenic cancer stem cells (CSC) in several cancers, mediates multidrug resistance (MDR) by transporting substrate anticancer drugs out of cancer cells and decreasing their intracellular accumulation. ABCB1 and ABCG2 are efflux transporters which have a major impact on the pharmacological behavior of numerous drugs. They are expressed in the intestine, liver, kidney, BBB and placenta. It has become evident that ABCB1 and ABCG2 modify the pharmaco/toxicokinetics in the placenta and fetus and may consequently affect the outcome of pregnancy.
Full Name
ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait