붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone expression plasmid, N-His 태그

    데이터시트리뷰관련제품프로토콜
    붉은털 원숭이(Rhesus) ACO2 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_001261164.2
    cDNA 크기:2343bp
    cDNA 설명:Full length Clone DNA of Macaca mulatta (Rhesus monkey) aconitase 2, mitochondrial with N terminal His tag.
    유전자 동의어:ACO2
    :Rhesus
    벡터:pCMV3-N-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone expression plasmid, N-His 태그 on other vectors
    붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90615-ACG288840
    붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90615-ACR288840
    붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그CG90615-ANG288840
    붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그CG90615-ANR288840
    붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90615-CF253470
    붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone expression plasmid, C-His 태그CG90615-CH253470
    붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90615-CM253470
    붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone expression plasmid, C-HA 태그CG90615-CY253470
    붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone in cloning vectorCG90615-G88420
    붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90615-NF253470
    붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone expression plasmid, N-His 태그CG90615-NH253470
    붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90615-NM253470
    붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone expression plasmid, N-HA 태그CG90615-NY253470
    붉은털원숭이 ACO2 / Aconitase 2 Gene ORF cDNA clone expression plasmidCG90615-UT253470
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    참고자료
  • Robbins AH, et al. (1989) The structure of aconitase. Proteins. 5 (4): 289-312.
  • Lauble H, et al. (1992) Crystal structures of aconitase with isocitrate and nitroisocitrate bound. Biochemistry. 31 (10): 2735-48.
  • Robbins AH, et al. (1989) Structure of activated aconitase: formation of the 4Fe-4S cluster in the crystal. Proc Natl Acad Sci. 86 (10): 3639-43.
  • Size / Price
    Cat No: CG90615-NH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".