After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Cynomolgus ACTL6B cDNA 클론 제품 정보
Gene_bank_ref_id:XM_005549245.1
cDNA 크기:1281bp
cDNA 설명:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) actin-like 6B with N terminal His tag.
유전자 동의어:ACTL6B
:Cynomolgus
벡터:pCMV3-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone expression plasmid, N-His 태그 on other vectors
필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90607-ACG265260
필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90607-ACR265260
필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그CG90607-ANG265260
필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그CG90607-ANR265260
필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90607-CF229890
필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone expression plasmid, C-His 태그CG90607-CH229890
필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90607-CM229890
필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone expression plasmid, C-HA 태그CG90607-CY229890
필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone in cloning vectorCG90607-G88420
필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90607-NF229890
필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone expression plasmid, N-His 태그CG90607-NH229890
필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90607-NM229890
필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone expression plasmid, N-HA 태그CG90607-NY229890
필리핀원숭이 Actin-like 단백질 6B/BAF53b Gene ORF cDNA clone expression plasmidCG90607-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: CG90607-NH
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
대량 주문 문의장바구니에 추가
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".