ALK-7 cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90067-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ALK-7 Reagents
CRO Services
Product recommended

All ALK-7 Reagents
ALK-7 cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1482 bp
Description
Full length Clone DNA of Rhesus activin A receptor, type IC with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALK-7 Background Information

ALK-7, also known as ALK7 and ACVR1C, belongs to the ALK family. It is a type I receptor for the TGFB family of signaling molecules. TGF-β is the prototype of a protein superfamily which, in humans, contains at least 35 members, including activins, inhibins, bone morphogenetic proteins, growth/differentiation factors, and Müllerian inhibiting substance. ALK-7 is a serine-threonine kinase that can cause the activation of one of the SMAD signal transducers, SMAD2. ALK-7 has a ligand known as Nodal. Nodal stimulates the secretion of TIMP-1 and inhibits matrix metalloproteinases MMP-2 and MMP-9 activity. The overexpression of Nodal or constitutively active ALK-7 decreases cell migration and invasion, whereas knock-down of Nodal and ALK-7 has the opposite effects.

Full Name
activin A receptor, type IC
References
  • Lin YY, et al. (2012) Functional dissection of lysine deacetylases reveals that HDAC1 and p300 regulate AMPK. Nature. 482(7384):251-5.
  • He C, et al. (2010) A large-scale candidate gene association study of age at menarche and age at natural menopause. Hum Genet. 128(5):515-27.
  • Watanabe R, et al. (2008) Insulin gene is a target in activin receptor-like kinase 7 signaling pathway in pancreatic beta-cells. Biochem Biophys Res Commun. 377(3):867-72.
  • ALK-7 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    ALK-7 cDNA ORF Clone in Cloning Vector, Rhesus CG90067-G
    ALK-7 cDNA ORF Clone, Rhesus, untagged CG90067-UT
    ALK-7 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90067-ACGLN
    ALK-7 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90067-ACG
    ALK-7 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90067-ACR
    ALK-7 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90067-CF
    ALK-7 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90067-NF
    ALK-7 cDNA ORF Clone, Rhesus, C-His tag CG90067-CH
    ALK-7 cDNA ORF Clone, Rhesus, N-His tag CG90067-NH
    ALK-7 cDNA ORF Clone, Rhesus, C-HA tag CG90067-CY
    ALK-7 cDNA ORF Clone, Rhesus, N-HA tag CG90067-NY
    ALK-7 cDNA ORF Clone, Rhesus, N-Myc tag CG90067-NM

    ALK-7 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ALK-7 cDNA ORF Clone in Cloning Vector, Human HG10869-M
    ALK-7 cDNA ORF Clone, Human, untagged HG10869-UT
    ALK-7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10869-ACGLN
    ALK-7 cDNA ORF Clone, Human, C-GFPSpark® tag HG10869-ACG
    ALK-7 cDNA ORF Clone, Human, C-OFPSpark® tag HG10869-ACR
    ALK-7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10869-CF
    ALK-7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10869-NF
    ALK-7 cDNA ORF Clone, Human, C-His tag HG10869-CH
    ALK-7 cDNA ORF Clone, Human, N-His tag HG10869-NH
    ALK-7 cDNA ORF Clone, Human, C-HA tag HG10869-CY
    ALK-7 cDNA ORF Clone, Human, N-HA tag HG10869-NY
    ALK-7 cDNA ORF Clone, Human, C-Myc tag HG10869-CM
    ALK-7 cDNA ORF Clone, Human, N-Myc tag HG10869-NM
    ALK-7 qPCR Primer Pairs, Human HP100758
    info info
    添加购物车成功! 添加购物车失败!