필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
    필리핀원숭이 ARF3 cDNA 클론 제품 정보
    Gene_bank_ref_id:XM_005570735.1
    cDNA 크기:546bp
    cDNA 설명:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ADP-ribosylation factor 3.
    유전자 동의어:ARF3
    :Cynomolgus
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid on other vectors
    필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90751-ACG265260
    필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90751-ACR265260
    필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90751-CF229890
    필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, C-His 태그CG90751-CH229890
    필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90751-CM229890
    필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, C-HA 태그CG90751-CY229890
    필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone in cloning vectorCG90751-G88420
    필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90751-NF229890
    필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, N-His 태그CG90751-NH229890
    필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90751-NM229890
    필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, N-HA 태그CG90751-NY229890
    필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmidCG90751-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    연구배경

    ARF3, also known as ADP-ribosylation factor 3, belongs to the RAS superfamily. Members of this family include ARF1, ARF2, ARF3, ARF4, ARF5 and ARF6. ARF3 gene is a member of the human ARF gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. ARF3 functions as an allosteric activator of the cholera toxin subunit, an ADP-ribosyltransferase. It is involved in protein trafficking and may modulate vesicle budding and uncoating within the Golgi apparatus.

    참고자료
  • Hirai M. et al., 1997, Genomics. 34 (2): 263-5.
  • Kanoh H. et al., 1997, J Biol Chem. 272 (9): 5421-9.
  • Boman. et al., 2002, Mol Biol Cell. 13 (9): 3078-95.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".