After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Cynomolgus ARF3 cDNA 클론 제품 정보
Gene_bank_ref_id:XM_005570735.1
cDNA 크기:546bp
cDNA 설명:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ADP-ribosylation factor 3.
유전자 동의어:ARF3
:Cynomolgus
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid on other vectors
필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90751-ACG265262
필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90751-ACR265262
필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90751-CF229893
필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, C-His 태그CG90751-CH229893
필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90751-CM229893
필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, C-HA 태그CG90751-CY229893
필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone in cloning vectorCG90751-G88421
필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90751-NF229893
필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, N-His 태그CG90751-NH229893
필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90751-NM229893
필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid, N-HA 태그CG90751-NY229893
필리핀원숭이 ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmidCG90751-UT229893
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

ARF3, also known as ADP-ribosylation factor 3, belongs to the RAS superfamily. Members of this family include ARF1, ARF2, ARF3, ARF4, ARF5 and ARF6. ARF3 gene is a member of the human ARF gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. ARF3 functions as an allosteric activator of the cholera toxin subunit, an ADP-ribosyltransferase. It is involved in protein trafficking and may modulate vesicle budding and uncoating within the Golgi apparatus.

참고자료
  • Hirai M. et al., 1997, Genomics. 34 (2): 263-5.
  • Kanoh H. et al., 1997, J Biol Chem. 272 (9): 5421-9.
  • Boman. et al., 2002, Mol Biol Cell. 13 (9): 3078-95.
  • Size / Price
    Cat No: CG90751-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".