Siah-interacting protein/CacyBP cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90601-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Siah-interacting protein/CacyBP Reagents

CRO Services

Product recommended


All Siah-interacting protein/CacyBP Reagents

Siah-interacting protein/CacyBP cDNA ORF Clone, Rhesus, N-His tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
687 bp
Description
Full length Clone DNA of Rhesus calcyclin binding protein with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Siah-interacting protein/CacyBP Background Information

Full Name
calcyclin binding protein

Siah-interacting protein/CacyBP cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Siah-interacting protein/CacyBP cDNA ORF Clone in Cloning Vector, Rhesus CG90601-G
Siah-interacting protein/CacyBP cDNA ORF Clone, Rhesus, untagged CG90601-UT
Siah-interacting protein/CacyBP Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90601-ACGLN
Siah-interacting protein/CacyBP cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90601-ACG
Siah-interacting protein/CacyBP cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90601-ANG
Siah-interacting protein/CacyBP cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90601-ACR
Siah-interacting protein/CacyBP cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90601-ANR
Siah-interacting protein/CacyBP cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90601-CF
Siah-interacting protein/CacyBP cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90601-NF
Siah-interacting protein/CacyBP cDNA ORF Clone, Rhesus, C-His tag CG90601-CH
Siah-interacting protein/CacyBP cDNA ORF Clone, Rhesus, C-HA tag CG90601-CY
Siah-interacting protein/CacyBP cDNA ORF Clone, Rhesus, N-HA tag CG90601-NY
Siah-interacting protein/CacyBP cDNA ORF Clone, Rhesus, C-Myc tag CG90601-CM
Siah-interacting protein/CacyBP cDNA ORF Clone, Rhesus, N-Myc tag CG90601-NM

Siah-interacting protein/CacyBP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Siah-interacting protein/CacyBP cDNA ORF Clone in Cloning Vector, Rat RG83978-U
Siah-interacting protein/CacyBP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83978-ACGLN

Siah-interacting protein/CacyBP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Siah-interacting protein/CacyBP cDNA ORF Clone in Cloning Vector, Mouse MG52142-G
Siah-interacting protein/CacyBP cDNA ORF Clone, Mouse, untagged MG52142-UT
Siah-interacting protein/CacyBP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52142-ACG
Siah-interacting protein/CacyBP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52142-ACGLN
Siah-interacting protein/CacyBP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52142-ANG
Siah-interacting protein/CacyBP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52142-ACR
Siah-interacting protein/CacyBP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52142-ANR
Siah-interacting protein/CacyBP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52142-CF
Siah-interacting protein/CacyBP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52142-NF
Siah-interacting protein/CacyBP cDNA ORF Clone, Mouse, C-His tag MG52142-CH
Siah-interacting protein/CacyBP cDNA ORF Clone, Mouse, N-His tag MG52142-NH
Siah-interacting protein/CacyBP cDNA ORF Clone, Mouse, C-HA tag MG52142-CY
Siah-interacting protein/CacyBP cDNA ORF Clone, Mouse, N-HA tag MG52142-NY
Siah-interacting protein/CacyBP cDNA ORF Clone, Mouse, C-Myc tag MG52142-CM
Siah-interacting protein/CacyBP cDNA ORF Clone, Mouse, N-Myc tag MG52142-NM
Siah-interacting protein/CacyBP qPCR Primer Pairs, Mouse MP202015

Siah-interacting protein/CacyBP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Siah-interacting protein/CacyBP cDNA ORF Clone in Cloning Vector, Human HG16983-U
Siah-interacting protein/CacyBP cDNA ORF Clone, Human, untagged HG16983-UT
Siah-interacting protein/CacyBP cDNA ORF Clone, Human, C-GFPSpark® tag HG16983-ACG
Siah-interacting protein/CacyBP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16983-ACGLN
Siah-interacting protein/CacyBP cDNA ORF Clone, Human, N-GFPSpark® tag HG16983-ANG
Siah-interacting protein/CacyBP cDNA ORF Clone, Human, C-OFPSpark® tag HG16983-ACR
Siah-interacting protein/CacyBP cDNA ORF Clone, Human, N-OFPSpark® tag HG16983-ANR
Siah-interacting protein/CacyBP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16983-CF
Siah-interacting protein/CacyBP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16983-NF
Siah-interacting protein/CacyBP cDNA ORF Clone, Human, C-His tag HG16983-CH
Siah-interacting protein/CacyBP cDNA ORF Clone, Human, N-His tag HG16983-NH
Siah-interacting protein/CacyBP cDNA ORF Clone, Human, C-HA tag HG16983-CY
Siah-interacting protein/CacyBP cDNA ORF Clone, Human, N-HA tag HG16983-NY
Siah-interacting protein/CacyBP cDNA ORF Clone, Human, C-Myc tag HG16983-CM
Siah-interacting protein/CacyBP cDNA ORF Clone, Human, N-Myc tag HG16983-NM
info info
添加购物车成功! 添加购物车失败!