After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone expression plasmid, C-Myc 태그

데이터시트리뷰관련제품프로토콜
Cynomolgus CALCOCO1 cDNA 클론 제품 정보
Gene_bank_ref_id:XM_005571041.1
cDNA 크기:2073bp
cDNA 설명:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) calcium binding and coiled-coil domain 1 with C terminal Myc tag.
유전자 동의어:CALCOCO1
:Cynomolgus
벡터:pCMV3-C-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone expression plasmid, C-Myc 태그 on other vectors
필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90426-ACG288840
필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90426-ACR288840
필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그CG90426-ANG288840
필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그CG90426-ANR288840
필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90426-CF253470
필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone expression plasmid, C-His 태그CG90426-CH253470
필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90426-CM253470
필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone expression plasmid, C-HA 태그CG90426-CY253470
필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone in cloning vectorCG90426-G88420
필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90426-NF253470
필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone expression plasmid, N-His 태그CG90426-NH253470
필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90426-NM253470
필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone expression plasmid, N-HA 태그CG90426-NY253470
필리핀원숭이 CoCoA/CALCOCO1 Gene ORF cDNA clone expression plasmidCG90426-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: CG90426-CM
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
대량 주문 문의장바구니에 추가
Contact Us
이미지
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".