필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
필리핀원숭이 CCAR2 cDNA 클론 제품 정보
Gene_bank_ref_id:XM_005562824.1
cDNA 크기:2772bp
cDNA 설명:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) cell cycle and apoptosis regulator 2 with C terminal His tag.
유전자 동의어:CCAR2
:Cynomolgus
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone expression plasmid, C-His 태그 on other vectors
필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90822-ACG383160
필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90822-ACR383160
필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그CG90822-ANG383160
필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그CG90822-ANR383160
필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90822-CF347790
필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone expression plasmid, C-His 태그CG90822-CH347790
필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90822-CM347790
필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone expression plasmid, C-HA 태그CG90822-CY347790
필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone in cloning vectorCG90822-G88420
필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90822-NF347790
필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone expression plasmid, N-His 태그CG90822-NH347790
필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90822-NM347790
필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone expression plasmid, N-HA 태그CG90822-NY347790
필리핀원숭이 CCAR2/KIAA1967 Gene ORF cDNA clone expression plasmidCG90822-UT347790
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: CG90822-CH
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
장바구니에 추가대량 주문 문의
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".