필리핀원숭이 CD151 Gene ORF cDNA clone expression plasmid

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
데이터시트리뷰관련제품프로토콜
필리핀원숭이 CD151 cDNA 클론 제품 정보
Gene_bank_ref_id:XM_005576813.1
cDNA 크기:762bp
cDNA 설명:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) CD151 molecule (Raph blood group).
유전자 동의어:CD151
:Cynomolgus
벡터:pCMV3-untagged
Plasmid:pCMV3-cynoCD151
제한 사이트:KpnI + XbaI(6.1kb+0.76kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 204C/T,411G/A,537C/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Cat No: CG90749-UT
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보In Stock
장바구니에 추가대량 주문 문의

Datasheet & Documentation

Contact Us
    최근에 조회한 품목
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".