필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmid, C-HA 태그

    데이터시트리뷰관련제품프로토콜
    필리핀원숭이 CHN1 cDNA 클론 제품 정보
    Gene_bank_ref_id:AB173631.1
    cDNA 크기:1005bp
    cDNA 설명:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) chimerin 1 with C terminal HA tag.
    유전자 동의어:CHN1
    :Cynomolgus
    벡터:pCMV3-C-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmid, C-HA 태그 on other vectors
    필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90836-ACG265260
    필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90836-ACR265260
    필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그CG90836-ANG265260
    필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그CG90836-ANR265260
    필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90836-CF229890
    필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmid, C-His 태그CG90836-CH229890
    필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90836-CM229890
    필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmid, C-HA 태그CG90836-CY229890
    필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone in cloning vectorCG90836-G88420
    필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90836-NF229890
    필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmid, N-His 태그CG90836-NH229890
    필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90836-NM229890
    필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmid, N-HA 태그CG90836-NY229890
    필리핀원숭이 CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmidCG90836-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    연구배경

    CHN1, also known as chimerin 1, is a TPase-activating protein for ras-related p21-rac and a phorbol ester receptor. It is predominantly expressed in neurons, and plays an important role in neuronal signal-transduction mechanisms. CHN1 is involved in the assembly of neuronal locomotor circuits as a direct effector of EPHA4 in axon guidance. The CHN1 gene provides instructions for making two very similar proteins called α1-chimaerin and α2-chimaerin. These proteins play an important role in the early development of the nervous system. In particular, they help regulate complex chemical signaling pathways during the formation and development of nerve cells (neurons). These proteins help guide the growth of axons and dendrites, which are specialized extensions of neurons that transmit and receive nerve impulses throughout the nervous system.

    참고자료
  • Miyake N. et al, 2010, Am J Med Genet A. 152 (1): 215-7.
  • Miyake N. et al., 2011, Invest Ophthalmol Vis Sci. 52 (9): 6321-8.
  • Volk AE. et al., 2010, Graefes Arch Clin Exp Ophthalmol. 248 (9): 1351-7.
  • Size / Price
    Cat No: CG90836-CY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".