COMMD7 cDNA ORF Clone, Cynomolgus, untagged

Cat: CG90723-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All COMMD7 Reagents
CRO Services
Product recommended

All COMMD7 Reagents
COMMD7 cDNA ORF Clone, Cynomolgus, untagged General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
603 bp
Description
Full length Clone DNA of Cynomolgus COMM domain containing 7.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COMMD7 Background Information
Full Name
COMM domain containing 7

COMMD7 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
COMMD7 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90723-G
COMMD7 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90723-ACG
COMMD7 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90723-ACGLN
COMMD7 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90723-ANG
COMMD7 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90723-ACR
COMMD7 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90723-ANR
COMMD7 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90723-CF
COMMD7 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90723-NF
COMMD7 cDNA ORF Clone, Cynomolgus, C-His tag CG90723-CH
COMMD7 cDNA ORF Clone, Cynomolgus, N-His tag CG90723-NH
COMMD7 cDNA ORF Clone, Cynomolgus, C-HA tag CG90723-CY
COMMD7 cDNA ORF Clone, Cynomolgus, N-HA tag CG90723-NY
COMMD7 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90723-CM
COMMD7 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90723-NM

COMMD7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COMMD7 cDNA ORF Clone in Cloning Vector, Mouse MG52446-G
COMMD7 cDNA ORF Clone, Mouse, untagged MG52446-UT
COMMD7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52446-ACGLN
COMMD7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52446-ACG
COMMD7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52446-ANG
COMMD7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52446-ACR
COMMD7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52446-ANR
COMMD7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52446-CF
COMMD7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52446-NF
COMMD7 cDNA ORF Clone, Mouse, C-His tag MG52446-CH
COMMD7 cDNA ORF Clone, Mouse, N-His tag MG52446-NH
COMMD7 cDNA ORF Clone, Mouse, C-HA tag MG52446-CY
COMMD7 cDNA ORF Clone, Mouse, N-HA tag MG52446-NY
COMMD7 cDNA ORF Clone, Mouse, C-Myc tag MG52446-CM
COMMD7 cDNA ORF Clone, Mouse, N-Myc tag MG52446-NM
COMMD7 qPCR Primer Pairs, Mouse MP202319
info info
添加购物车成功! 添加购物车失败!