붉은털원숭이 JAB1/CSN5 Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
    필리핀원숭이 COPS5 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_001260680.1
    cDNA 크기:1005bp
    cDNA 설명:Full length Clone DNA of Macaca mulatta (Rhesus monkey) COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis).
    유전자 동의어:COPS5
    :Rhesus
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    붉은털원숭이 JAB1/CSN5 Gene ORF cDNA clone expression plasmid on other vectors
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".