DNAJC12 cDNA ORF Clone, Cynomolgus, N-HA tag

Cat: CG90425-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DNAJC12 Reagents
CRO Services
Product recommended

All DNAJC12 Reagents
DNAJC12 cDNA ORF Clone, Cynomolgus, N-HA tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
597 bp
Description
Full length Clone DNA of Cynomolgus DnaJ (Hsp40) homolog, subfamily C, member 12 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DNAJC12 Background Information
Full Name
DnaJ (Hsp40) homolog, subfamily C, member 12

DNAJC12 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
DNAJC12 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90425-G
DNAJC12 cDNA ORF Clone, Cynomolgus, untagged CG90425-UT
DNAJC12 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90425-ACG
DNAJC12 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90425-ACGLN
DNAJC12 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90425-ANG
DNAJC12 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90425-ACR
DNAJC12 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90425-ANR
DNAJC12 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90425-CF
DNAJC12 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90425-NF
DNAJC12 cDNA ORF Clone, Cynomolgus, C-His tag CG90425-CH
DNAJC12 cDNA ORF Clone, Cynomolgus, N-His tag CG90425-NH
DNAJC12 cDNA ORF Clone, Cynomolgus, C-HA tag CG90425-CY
DNAJC12 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90425-CM
DNAJC12 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90425-NM

DNAJC12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DNAJC12 cDNA ORF Clone in Cloning Vector, Mouse MG53650-U
DNAJC12 cDNA ORF Clone, Mouse, untagged MG53650-UT
DNAJC12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53650-ACGLN
DNAJC12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53650-ACG
DNAJC12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53650-ANG
DNAJC12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53650-ACR
DNAJC12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53650-ANR
DNAJC12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53650-CF
DNAJC12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53650-NF
DNAJC12 cDNA ORF Clone, Mouse, C-His tag MG53650-CH
DNAJC12 cDNA ORF Clone, Mouse, N-His tag MG53650-NH
DNAJC12 cDNA ORF Clone, Mouse, C-HA tag MG53650-CY
DNAJC12 cDNA ORF Clone, Mouse, N-HA tag MG53650-NY
DNAJC12 cDNA ORF Clone, Mouse, C-Myc tag MG53650-CM
DNAJC12 cDNA ORF Clone, Mouse, N-Myc tag MG53650-NM
info info
添加购物车成功! 添加购物车失败!