EEF1B2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag

Cat: CG90457-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EEF1B2 Reagents
CRO Services
Product recommended

All EEF1B2 Reagents
EEF1B2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
678 bp
Description
Full length Clone DNA of Cynomolgus eukaryotic translation elongation factor 1 beta 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EEF1B2 Background Information

EF1B, also known as EEF1B2, is a translation elongation factor. It belongs to the EF-1-beta/EF-1-delta family. Elongation factors are a set of proteins that are used in protein synthesis in the cell. In the ribosome, they facilitate translational elongation, from the formation of the first peptide bond to the formation of the last one. EF1B is more complex in eukaryotes than in bacteria, and consists of three subunits: EF1B-alpha, EF1B-gamma and EF1B-beta. EF1B contains 1 GST C-terminal domain. It is involved in the transfer of aminoacylated tRNAs to the ribosome. EF1B is required to regenerate EF1A from its inactive form (EF1A-GDP) to its active form (EF1A-GTP). EF1A is then ready to interact with a new aminoacyl-tRNA to begin the cycle again.

Full Name
eukaryotic translation elongation factor 1 beta 2
References
  • Pizzuti A. et al., 1994, Biochem Biophys Res Commun. 197 (1): 154-62.
  • Rual. et al., 2005, Nature. 437 (7062): 1173-8.
  • Stelzl. et al., 2005, Cell. 122 (6): 957-68.
  • Sang Lee. et al., 2002, Biochem Biophys Res Commun. 291 (1): 158-64.
  • EEF1B2 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    EEF1B2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90457-G
    EEF1B2 cDNA ORF Clone, Cynomolgus, untagged CG90457-UT
    EEF1B2 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90457-ACGLN
    EEF1B2 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90457-ACG
    EEF1B2 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90457-ANG
    EEF1B2 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90457-ACR
    EEF1B2 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90457-ANR
    EEF1B2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90457-CF
    EEF1B2 cDNA ORF Clone, Cynomolgus, C-His tag CG90457-CH
    EEF1B2 cDNA ORF Clone, Cynomolgus, N-His tag CG90457-NH
    EEF1B2 cDNA ORF Clone, Cynomolgus, C-HA tag CG90457-CY
    EEF1B2 cDNA ORF Clone, Cynomolgus, N-HA tag CG90457-NY
    EEF1B2 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90457-CM
    EEF1B2 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90457-NM

    EEF1B2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    EEF1B2 cDNA ORF Clone in Cloning Vector, Mouse MG51266-G
    EEF1B2 cDNA ORF Clone, Mouse, untagged MG51266-UT
    EEF1B2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51266-ACG
    EEF1B2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51266-ACGLN
    EEF1B2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51266-ANG
    EEF1B2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51266-ACR
    EEF1B2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51266-ANR
    EEF1B2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51266-CF
    EEF1B2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51266-NF
    EEF1B2 cDNA ORF Clone, Mouse, C-His tag MG51266-CH
    EEF1B2 cDNA ORF Clone, Mouse, N-His tag MG51266-NH
    EEF1B2 cDNA ORF Clone, Mouse, C-HA tag MG51266-CY
    EEF1B2 cDNA ORF Clone, Mouse, N-HA tag MG51266-NY
    EEF1B2 cDNA ORF Clone, Mouse, C-Myc tag MG51266-CM
    EEF1B2 cDNA ORF Clone, Mouse, N-Myc tag MG51266-NM
    EEF1B2 qPCR Primer Pairs, Mouse MP201148

    EEF1B2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EEF1B2 cDNA ORF Clone in Cloning Vector, Human HG14611-G
    EEF1B2 cDNA ORF Clone, Human, untagged HG14611-UT
    EEF1B2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14611-ACGLN
    EEF1B2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14611-ACG
    EEF1B2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14611-ANG
    EEF1B2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14611-ACR
    EEF1B2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14611-ANR
    EEF1B2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14611-CF
    EEF1B2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14611-NF
    EEF1B2 cDNA ORF Clone, Human, C-His tag HG14611-CH
    EEF1B2 cDNA ORF Clone, Human, N-His tag HG14611-NH
    EEF1B2 cDNA ORF Clone, Human, C-HA tag HG14611-CY
    EEF1B2 cDNA ORF Clone, Human, N-HA tag HG14611-NY
    EEF1B2 cDNA ORF Clone, Human, C-Myc tag HG14611-CM
    EEF1B2 cDNA ORF Clone, Human, N-Myc tag HG14611-NM
    EEF1B2 qPCR Primer Pairs, Human HP103245
    info info
    添加购物车成功! 添加购物车失败!