붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Cynomolgus ENO1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001195611.1
cDNA 크기:1305bp
cDNA 설명:Full length Clone DNA of Macaca mulatta (Rhesus monkey) enolase 1, (alpha) with C terminal His tag.
유전자 동의어:ENO1
:Rhesus
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-His 태그 on other vectors
붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90355-ACG265260
붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90355-ACR265260
붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그CG90355-ANG265260
붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그CG90355-ANR265260
붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90355-CF229890
붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-His 태그CG90355-CH229890
붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90355-CM229890
붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-HA 태그CG90355-CY229890
붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone in cloning vectorCG90355-G88420
붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90355-NF229890
붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-His 태그CG90355-NH229890
붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90355-NM229890
붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-HA 태그CG90355-NY229890
붉은털원숭이 ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmidCG90355-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
참고자료
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • Size / Price
    Cat No: CG90355-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".