필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
    필리핀원숭이 FAH cDNA 클론 제품 정보
    Gene_bank_ref_id:XM_005560246.1
    cDNA 크기:1260bp
    cDNA 설명:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) fumarylacetoacetate hydrolase (fumarylacetoacetase).
    유전자 동의어:FAH
    :Cynomolgus
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone expression plasmid on other vectors
    필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90717-ACG265260
    필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90717-ACR265260
    필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그CG90717-ANG265260
    필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그CG90717-ANR265260
    필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90717-CF229890
    필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone expression plasmid, C-His 태그CG90717-CH229890
    필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90717-CM229890
    필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone expression plasmid, C-HA 태그CG90717-CY229890
    필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone in cloning vectorCG90717-G88420
    필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90717-NF229890
    필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone expression plasmid, N-His 태그CG90717-NH229890
    필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90717-NM229890
    필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone expression plasmid, N-HA 태그CG90717-NY229890
    필리핀원숭이 fumarylacetoacetate hydrolase Gene ORF cDNA clone expression plasmidCG90717-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    Size / Price
    Cat No: CG90717-UT
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".