FBXO22 cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90612-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FBXO22 Reagents
CRO Services
Product recommended

All FBXO22 Reagents
FBXO22 cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1215 bp
Description
Full length Clone DNA of Rhesus F-box protein 22 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FBXO22 Background Information
Full Name
F-box protein 22

FBXO22 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
FBXO22 cDNA ORF Clone in Cloning Vector, Rhesus CG90612-G
FBXO22 cDNA ORF Clone, Rhesus, untagged CG90612-UT
FBXO22 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90612-ACG
FBXO22 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90612-ACGLN
FBXO22 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90612-ANG
FBXO22 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90612-ACR
FBXO22 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90612-ANR
FBXO22 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90612-CF
FBXO22 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90612-NF
FBXO22 cDNA ORF Clone, Rhesus, C-His tag CG90612-CH
FBXO22 cDNA ORF Clone, Rhesus, C-HA tag CG90612-CY
FBXO22 cDNA ORF Clone, Rhesus, N-HA tag CG90612-NY
FBXO22 cDNA ORF Clone, Rhesus, C-Myc tag CG90612-CM
FBXO22 cDNA ORF Clone, Rhesus, N-Myc tag CG90612-NM

FBXO22 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FBXO22 cDNA ORF Clone in Cloning Vector, Mouse MG5A5452-U
FBXO22 cDNA ORF Clone, Mouse, untagged MG5A5452-UT
FBXO22 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5452-ACGLN
FBXO22 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5452-ACG
FBXO22 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5452-ANG
FBXO22 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5452-ACR
FBXO22 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5452-ANR
FBXO22 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5452-CF
FBXO22 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5452-NF
FBXO22 cDNA ORF Clone, Mouse, C-His tag MG5A5452-CH
FBXO22 cDNA ORF Clone, Mouse, N-His tag MG5A5452-NH
FBXO22 cDNA ORF Clone, Mouse, C-HA tag MG5A5452-CY
FBXO22 cDNA ORF Clone, Mouse, N-HA tag MG5A5452-NY
FBXO22 cDNA ORF Clone, Mouse, C-Myc tag MG5A5452-CM
FBXO22 cDNA ORF Clone, Mouse, N-Myc tag MG5A5452-NM

FBXO22 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FBXO22 cDNA ORF Clone in Cloning Vector, Human HG17164-U
FBXO22 cDNA ORF Clone, Human, untagged HG17164-UT
FBXO22 cDNA ORF Clone, Human, C-GFPSpark® tag HG17164-ACG
FBXO22 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17164-ACGLN
FBXO22 cDNA ORF Clone, Human, N-GFPSpark® tag HG17164-ANG
FBXO22 cDNA ORF Clone, Human, C-OFPSpark® tag HG17164-ACR
FBXO22 cDNA ORF Clone, Human, N-OFPSpark® tag HG17164-ANR
FBXO22 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17164-CF
FBXO22 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17164-NF
FBXO22 cDNA ORF Clone, Human, C-His tag HG17164-CH
FBXO22 cDNA ORF Clone, Human, N-His tag HG17164-NH
FBXO22 cDNA ORF Clone, Human, C-HA tag HG17164-CY
FBXO22 cDNA ORF Clone, Human, N-HA tag HG17164-NY
FBXO22 cDNA ORF Clone, Human, C-Myc tag HG17164-CM
FBXO22 cDNA ORF Clone, Human, N-Myc tag HG17164-NM
info info
添加购物车成功! 添加购物车失败!