After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid, C-Myc 태그

데이터시트리뷰관련제품프로토콜
Cynomolgus FGF12 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001194006.1
cDNA 크기:732bp
cDNA 설명:Full length Clone DNA of Macaca mulatta (Rhesus monkey) fibroblast growth factor 12 with C terminal Myc tag.
유전자 동의어:FGF12
:Rhesus
벡터:pCMV3-C-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid, C-Myc 태그 on other vectors
붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90074-ACG265260
붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90074-ACR265260
붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그CG90074-ANG265260
붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그CG90074-ANR265260
붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90074-CF229890
붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid, C-His 태그CG90074-CH229890
붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90074-CM229890
붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid, C-HA 태그CG90074-CY229890
붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone in cloning vectorCG90074-G88420
붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90074-NF229890
붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid, N-His 태그CG90074-NH229890
붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90074-NM229890
붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid, N-HA 태그CG90074-NY229890
붉은털원숭이 FGF12 / FGF-12 Gene ORF cDNA clone expression plasmidCG90074-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

FGF12 is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. FGF12 lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, FGF12 accumulated in the nucleus, but was not secreted. The specific function of FGF12 gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.

참고자료
  • Liu Y. et al., 1997, Cytogenet Cell Genet. 78 (1): 48-9.
  • Robertson NG. et al., 1995, Genomics. 23 (1): 42-50.
  • Smallwood PM. et al., 1996, Proc Natl Acad Sci. 93 (18): 9850-7.
  • Size / Price
    Cat No: CG90074-CM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".