KGF cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90071-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All KGF Reagents
CRO Services
Product recommended

All KGF Reagents
KGF cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
585 bp
Description
Full length Clone DNA of Rhesus fibroblast growth factor 7 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KGF Background Information
Full Name
fibroblast growth factor 7

KGF cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
KGF cDNA ORF Clone in Cloning Vector, Rhesus CG90071-G
KGF cDNA ORF Clone, Rhesus, untagged CG90071-UT
KGF Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90071-ACGLN
KGF cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90071-ACG
KGF cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90071-ACR
KGF cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90071-CF
KGF cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90071-NF
KGF cDNA ORF Clone, Rhesus, C-His tag CG90071-CH
KGF cDNA ORF Clone, Rhesus, N-His tag CG90071-NH
KGF cDNA ORF Clone, Rhesus, C-HA tag CG90071-CY
KGF cDNA ORF Clone, Rhesus, N-HA tag CG90071-NY
KGF cDNA ORF Clone, Rhesus, N-Myc tag CG90071-NM

KGF cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
KGF cDNA ORF Clone in Cloning Vector, Canine DG70040-G
KGF cDNA ORF Clone, Canine, untagged DG70040-UT
KGF Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70040-ACGLN
KGF cDNA ORF Clone, Canine, C-GFPSpark® tag DG70040-ACG
KGF cDNA ORF Clone, Canine, C-OFPSpark® tag DG70040-ACR
KGF cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70040-CF
KGF cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70040-NF
KGF cDNA ORF Clone, Canine, C-His tag DG70040-CH
KGF cDNA ORF Clone, Canine, N-His tag DG70040-NH
KGF cDNA ORF Clone, Canine, C-HA tag DG70040-CY
KGF cDNA ORF Clone, Canine, N-HA tag DG70040-NY
KGF cDNA ORF Clone, Canine, C-Myc tag DG70040-CM
KGF cDNA ORF Clone, Canine, N-Myc tag DG70040-NM

KGF cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KGF cDNA ORF Clone in Cloning Vector, Mouse MG50394-M
KGF cDNA ORF Clone, Mouse, untagged MG50394-UT
KGF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50394-ACGLN
KGF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50394-ACG
KGF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50394-ACR
KGF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50394-CF
KGF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50394-NF
KGF cDNA ORF Clone, Mouse, C-His tag MG50394-CH
KGF cDNA ORF Clone, Mouse, N-His tag MG50394-NH
KGF cDNA ORF Clone, Mouse, C-HA tag MG50394-CY
KGF cDNA ORF Clone, Mouse, N-HA tag MG50394-NY
KGF cDNA ORF Clone, Mouse, C-Myc tag MG50394-CM
KGF cDNA ORF Clone, Mouse, N-Myc tag MG50394-NM
KGF qPCR Primer Pairs, Mouse MP200412

KGF cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KGF cDNA ORF Clone in Cloning Vector, Human HG10210-M
KGF cDNA ORF Clone, Human, untagged HG10210-UT
KGF cDNA ORF Clone, Human, C-GFPSpark® tag HG10210-ACG
KGF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10210-ACGLN
KGF cDNA ORF Clone, Human, C-OFPSpark® tag HG10210-ACR
KGF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10210-CF
KGF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10210-NF
KGF cDNA ORF Clone, Human, C-His tag HG10210-CH
KGF cDNA ORF Clone, Human, N-His tag HG10210-NH
KGF cDNA ORF Clone, Human, C-HA tag HG10210-CY
KGF cDNA ORF Clone, Human, N-HA tag HG10210-NY
KGF cDNA ORF Clone, Human, C-Myc tag HG10210-CM
KGF cDNA ORF Clone, Human, N-Myc tag HG10210-NM
KGF qPCR Primer Pairs, Human HP100269
info info
添加购物车成功! 添加购物车失败!