필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-Myc 태그

데이터시트리뷰관련제품프로토콜
Cynomolgus GOT1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001284930.1
cDNA 크기:1242bp
cDNA 설명:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) Aspartate aminotransferase, cytoplasmic with N terminal Myc tag.
유전자 동의어:cCAT, cAspAT
:Cynomolgus
벡터:pCMV3-N-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-Myc 태그 on other vectors
필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90649-ACG265260
필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90649-ACR265260
필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그CG90649-ANG265260
필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그CG90649-ANR265260
필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90649-CF229890
필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, C-His 태그CG90649-CH229890
필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90649-CM229890
필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, C-HA 태그CG90649-CY229890
필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone in cloning vectorCG90649-G88420
필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90649-NF229890
필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-His 태그CG90649-NH229890
필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90649-NM229890
필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-HA 태그CG90649-NY229890
필리핀원숭이 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmidCG90649-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

참고자료
  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Size / Price
    Cat No: CG90649-NM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".