HDGF cDNA ORF Clone, Cynomolgus, N-Myc tag

Cat: CG90670-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HDGF Reagents
CRO Services
Product recommended

All HDGF Reagents
HDGF cDNA ORF Clone, Cynomolgus, N-Myc tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
723 bp
Description
Full length Clone DNA of Cynomolgus hepatoma-derived growth factor with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HDGF Background Information
Full Name
hepatoma-derived growth factor

HDGF cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
HDGF cDNA ORF Clone in Cloning Vector, Cynomolgus CG90670-G
HDGF cDNA ORF Clone, Cynomolgus, untagged CG90670-UT
HDGF Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90670-ACGLN
HDGF cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90670-ACG
HDGF cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90670-ANG
HDGF cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90670-ACR
HDGF cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90670-ANR
HDGF cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90670-CF
HDGF cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90670-NF
HDGF cDNA ORF Clone, Cynomolgus, C-His tag CG90670-CH
HDGF cDNA ORF Clone, Cynomolgus, N-His tag CG90670-NH
HDGF cDNA ORF Clone, Cynomolgus, C-HA tag CG90670-CY
HDGF cDNA ORF Clone, Cynomolgus, N-HA tag CG90670-NY
HDGF cDNA ORF Clone, Cynomolgus, C-Myc tag CG90670-CM

HDGF cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HDGF cDNA ORF Clone in Cloning Vector, Mouse MG59070-U
HDGF cDNA ORF Clone, Mouse, untagged MG59070-UT
HDGF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59070-ACGLN
HDGF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59070-ACG
HDGF cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59070-ANG
HDGF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59070-ACR
HDGF cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59070-ANR
HDGF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59070-CF
HDGF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59070-NF
HDGF cDNA ORF Clone, Mouse, C-His tag MG59070-CH
HDGF cDNA ORF Clone, Mouse, N-His tag MG59070-NH
HDGF cDNA ORF Clone, Mouse, C-HA tag MG59070-CY
HDGF cDNA ORF Clone, Mouse, N-HA tag MG59070-NY
HDGF cDNA ORF Clone, Mouse, C-Myc tag MG59070-CM
HDGF cDNA ORF Clone, Mouse, N-Myc tag MG59070-NM

HDGF cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HDGF cDNA ORF Clone in Cloning Vector, Human HG12114-M
HDGF cDNA ORF Clone, Human, untagged HG12114-UT
HDGF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12114-ACGLN
HDGF cDNA ORF Clone, Human, C-GFPSpark® tag HG12114-ACG
HDGF cDNA ORF Clone, Human, N-GFPSpark® tag HG12114-ANG
HDGF cDNA ORF Clone, Human, C-OFPSpark® tag HG12114-ACR
HDGF cDNA ORF Clone, Human, N-OFPSpark® tag HG12114-ANR
HDGF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12114-CF
HDGF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12114-NF
HDGF cDNA ORF Clone, Human, C-His tag HG12114-CH
HDGF cDNA ORF Clone, Human, N-His tag HG12114-NH
HDGF cDNA ORF Clone, Human, C-HA tag HG12114-CY
HDGF cDNA ORF Clone, Human, N-HA tag HG12114-NY
HDGF cDNA ORF Clone, Human, C-Myc tag HG12114-CM
HDGF cDNA ORF Clone, Human, N-Myc tag HG12114-NM
HDGF qPCR Primer Pairs, Human HP101641
info info
添加购物车成功! 添加购物车失败!