After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

붉은털원숭이 IL18/IL-18/Interleukin 18 Gene ORF cDNA clone expression plasmid, N-Myc 태그

데이터시트리뷰관련제품프로토콜
Cynomolgus IL18 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001032834.2
cDNA 크기:582bp
cDNA 설명:Full length Clone DNA of Macaca mulatta (Rhesus monkey) interleukin 18 (interferon-gamma-inducing factor) with N terminal Myc tag.
유전자 동의어:IL18
:Rhesus
벡터:pCMV3-SP-N-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

붉은털원숭이 IL18/IL-18/Interleukin 18 Gene ORF cDNA clone expression plasmid, N-Myc 태그 on other vectors
Product nameProduct name
연구배경

Interleukin-18 (IL-18, also known as interferon-gamma inducing factor) is a proinflammatory cytokine that belongs to the IL-1 superfamily and is produced by macrophages and other cells. This cytokine can induce the IFN-gamma production of T cells. The combination of IL-18 and IL12 has been shown to inhibit IL4 dependent IgE and IgG1 production, and enhance IgG2a production of B cells. IL-18 binding protein (IL18BP) can specifically interact with this cytokine, and thus negatively regulate its biological activity. IL-18 is an IL-1−like cytokine that requires cleavage with caspase-1 to become active, was found to increase IgE production in a CD4+ T cells-, IL-4− and STAT6−dependent fashion. IL-18 and T cell receptor−mediated stimulation could induce naïve CD4+ T cells to develop into IL-4−producing cells in vitro. Thus, caspase-1 and IL-18 may be critical in regulation of IgE production in vivo, providing a potential therapeutic target for allergic disorders. IL-18 production in primary synovial cultures and purified synovial fibroblasts was, in turn, upregulated by TNF-α and IL-1β, suggesting that monokine expression can feed back to promote Th1 cell development in synovial membrane. Besides, synergistic combinations of IL-18, IL-12, and IL-15 may be of importance in sustaining both Th1 responses and monokine production in RA.

참고자료
  • Dinarello CA. (1999) IL-18: A TH1-inducing, proinflammatory cytokine and new member of the IL-1 family. J Allergy Clin Immunol. 103: 11-24.
  • Takeda K, et al.. (1998) Defective NK cell activity and Th1 response in IL-18-deficient mice. Immunity. 8(3): 383-90.
  • Gracie JA, et al.. (1999) A proinflammatory role for IL-18 in rheumatoid arthritis. J Clin Invest. 104(10): 1393-401.
  • Size / Price
    Cat No: CG90011-NM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".