IL-1 beta cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90010-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IL-1 beta Reagents
CRO Services
Product recommended

All IL-1 beta Reagents
IL-1 beta cDNA ORF Clone, Rhesus, N-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
810 bp
Description
Full length Clone DNA of Rhesus interleukin 1, beta with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-1 beta Background Information

Interleukin-1 beta (IL1 beta or IL1B) also known as catabolin, is a member of the interleukin 1 cytokine family. IL1 is a pleiotropic cytokine. It is involved in the inflammatory response, cell growth, and tissue repair in the cortex. The IL1 superfamily consists of three members, IL1A (IL1 alpha), IL1B (IL1 beta), and IL1 receptor antagonist (IL1Ra). In clinical, it has been reported that Interleukin (IL)-1 may influence Th1 / Th2 immune responsiveness and has been implicated in the establishment of successful pregnancy. Proinflammatory interleukin (IL)-1 gene polymorphisms associated with high levels of IL-1beta activity increase the risk for hypochlorhydria and distal gastric carcinoma. IL1B polymorphisms may be involved in susceptibility to SSc. Moreover, the IL2-384-G allele may be a marker for the limited phenotype of systemic sclerosis (SSc).

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
interleukin 1, beta
References
  • Kim SH, et al. (2008) Association of -31TC and -511 CT polymorphisms in the interleukin 1 beta (IL1B) promoter in Korean keratoconus patients. Mol Vis. 14:2109-16.
  • Wang ZC, et al. (2002) T helper 1-type immunity to trophoblast antigens in women with a history of recurrent pregnancy loss is associated with polymorphism of the IL1B promoter region. Genes Immun. 3(1): 38-42.
  • Mattuzzi S, et al. (2007) Association of polymorphisms in the IL1B and IL2 genes with susceptibility and severity of systemic sclerosis. J Rheumatol. 34(5): 997-1004.
  • IL-1 beta cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL-1 beta cDNA ORF Clone in Cloning Vector, Rhesus CG90010-M
    IL-1 beta cDNA ORF Clone, Rhesus, untagged CG90010-UT
    IL-1 beta Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90010-ACGLN
    IL-1 beta cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90010-ACG
    IL-1 beta cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90010-ACR
    IL-1 beta cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90010-CF
    IL-1 beta cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90010-NF
    IL-1 beta cDNA ORF Clone, Rhesus, C-His tag CG90010-CH
    IL-1 beta cDNA ORF Clone, Rhesus, N-His tag CG90010-NH
    IL-1 beta cDNA ORF Clone, Rhesus, C-HA tag CG90010-CY
    IL-1 beta cDNA ORF Clone, Rhesus, N-HA tag CG90010-NY
    IL-1 beta cDNA ORF Clone, Rhesus, C-Myc tag CG90010-CM

    IL-1 beta cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL-1 beta cDNA ORF Clone in Cloning Vector, Canine DG70018-G
    IL-1 beta cDNA ORF Clone, Canine, untagged DG70018-UT
    IL-1 beta cDNA ORF Clone, Canine, C-GFPSpark® tag DG70018-ACG
    IL-1 beta Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70018-ACGLN
    IL-1 beta cDNA ORF Clone, Canine, C-OFPSpark® tag DG70018-ACR
    IL-1 beta cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70018-CF
    IL-1 beta cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70018-NF
    IL-1 beta cDNA ORF Clone, Canine, C-His tag DG70018-CH
    IL-1 beta cDNA ORF Clone, Canine, N-His tag DG70018-NH
    IL-1 beta cDNA ORF Clone, Canine, C-HA tag DG70018-CY
    IL-1 beta cDNA ORF Clone, Canine, N-HA tag DG70018-NY
    IL-1 beta cDNA ORF Clone, Canine, C-Myc tag DG70018-CM
    IL-1 beta cDNA ORF Clone, Canine, N-Myc tag DG70018-NM

    IL-1 beta cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    IL-1 beta cDNA ORF Clone in Cloning Vector, Rabbit TG65004-G
    IL-1 beta cDNA ORF Clone, Rabbit, untagged TG65004-UT
    IL-1 beta Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65004-ACGLN
    IL-1 beta cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65004-ACG
    IL-1 beta cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65004-ACR
    IL-1 beta cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65004-CF
    IL-1 beta cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65004-NF
    IL-1 beta cDNA ORF Clone, Rabbit, C-His tag TG65004-CH
    IL-1 beta cDNA ORF Clone, Rabbit, N-His tag TG65004-NH
    IL-1 beta cDNA ORF Clone, Rabbit, C-HA tag TG65004-CY
    IL-1 beta cDNA ORF Clone, Rabbit, N-HA tag TG65004-NY
    IL-1 beta cDNA ORF Clone, Rabbit, C-Myc tag TG65004-CM
    IL-1 beta cDNA ORF Clone, Rabbit, N-Myc tag TG65004-NM

    IL-1 beta cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL-1 beta cDNA ORF Clone in Cloning Vector, Rat RG80023-M
    IL-1 beta cDNA ORF Clone, Rat, untagged RG80023-UT
    IL-1 beta Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80023-ACGLN
    IL-1 beta cDNA ORF Clone, Rat, C-GFPSpark® tag RG80023-ACG
    IL-1 beta cDNA ORF Clone, Rat, C-OFPSpark® tag RG80023-ACR
    IL-1 beta cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80023-CF
    IL-1 beta cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80023-NF
    IL-1 beta cDNA ORF Clone, Rat, C-His tag RG80023-CH
    IL-1 beta cDNA ORF Clone, Rat, N-His tag RG80023-NH
    IL-1 beta cDNA ORF Clone, Rat, C-HA tag RG80023-CY
    IL-1 beta cDNA ORF Clone, Rat, N-HA tag RG80023-NY
    IL-1 beta cDNA ORF Clone, Rat, C-Myc tag RG80023-CM
    IL-1 beta cDNA ORF Clone, Rat, N-Myc tag RG80023-NM
    IL-1 beta qPCR Primer Pairs, Rat RP300022

    IL-1 beta cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-1 beta cDNA ORF Clone in Cloning Vector, Mouse MG50101-M
    IL-1 beta cDNA ORF Clone, Mouse, untagged MG50101-UT
    IL-1 beta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50101-ACG
    IL-1 beta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50101-ACGLN
    IL-1 beta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50101-ACR
    IL-1 beta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50101-CF
    IL-1 beta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50101-NF
    IL-1 beta cDNA ORF Clone, Mouse, C-His tag MG50101-CH
    IL-1 beta cDNA ORF Clone, Mouse, N-His tag MG50101-NH
    IL-1 beta cDNA ORF Clone, Mouse, C-HA tag MG50101-CY
    IL-1 beta cDNA ORF Clone, Mouse, N-HA tag MG50101-NY
    IL-1 beta cDNA ORF Clone, Mouse, C-Myc tag MG50101-CM
    IL-1 beta cDNA ORF Clone, Mouse, N-Myc tag MG50101-NM
    IL-1 beta qPCR Primer Pairs, Mouse MP200131

    IL-1 beta cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-1 beta cDNA ORF Clone in Cloning Vector, Human HG10139-G
    IL-1 beta cDNA ORF Clone, Human, untagged HG10139-UT
    IL-1 beta cDNA ORF Clone, Human, C-GFPSpark® tag HG10139-ACG
    IL-1 beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10139-ACGLN
    IL-1 beta cDNA ORF Clone, Human, C-OFPSpark® tag HG10139-ACR
    IL-1 beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10139-CF
    IL-1 beta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10139-NF
    IL-1 beta cDNA ORF Clone, Human, C-His tag HG10139-CH
    IL-1 beta cDNA ORF Clone, Human, N-His tag HG10139-NH
    IL-1 beta cDNA ORF Clone, Human, C-HA tag HG10139-CY
    IL-1 beta cDNA ORF Clone, Human, N-HA tag HG10139-NY
    IL-1 beta cDNA ORF Clone, Human, C-Myc tag HG10139-CM
    IL-1 beta cDNA ORF Clone, Human, N-Myc tag HG10139-NM
    IL-1 beta qPCR Primer Pairs, Human HP100210
    info info
    添加购物车成功! 添加购物车失败!