LAYN cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag

Cat: CG90160-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LAYN Reagents
CRO Services
Product recommended

All LAYN Reagents
LAYN cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1125 bp
Description
Full length Clone DNA of Rhesus layilin with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LAYN Background Information

Layilin, a recently characterized as a 55 kDa transmembrane protein with homology to C-type lectins, is present in numerous cell lines and tissue extracts. As one of the adaptor proteins, talin mediates the interactions between the actin filaments and the cell membrane by binding to integral membrane proteins and to the cytoskeleton. Layilin is a newly identified membrane-binding site for talin in peripheral ruffles of spreading cells, a ten-amino acid motif in the layilin cytoplasmic domain is sufficient for talin binding, and its adjacent LH2-LH3 tandem arrays in the cytoplasmic domain provide docking sites for talin. Furthermore, talin binds layilin, PIPK1gamma and integrins in similar although subtly different ways. Layilin binds specifically to hyaluronan (HA) through its extracellular domain, a ubiquitous extracellular matrix component in most animal tissues and body fluids, but not to other tested glycosaminoglycans. The research suggests that layilin may mediate signals from extracellular matrix to the cell cytoskeleton via interaction with different intracellular binding partners and thereby be involved in the modulation of cortical structures in the cell. All the above actions reveal an interesting parallel between layilin and the known HA receptor CD44. In addition, merlin and radixin have been identified as different intracellular binding partners of layilin. Accordingly, it has been suggested that layilin plays roles in a variety of cellular processes, including cell shape, adhesion, motility, and homeostasis, as well as signal transduction. In addition, layilin might play an important role in the process of invasion and lymphatic metastasis of lung carcinoma.

Full Name
layilin
References
  • Borowsky ML, et al. (1998) Layilin, a novel talin-binding transmembrane protein homologous with C-type lectins, is localized in membrane ruffles.J Cell Biol. 143(2):429-42.
  • Bono P, et al. (2001) Layilin, a novel integral membrane protein, is a hyaluronan receptor. Mol Biol Cell. 12(4)891-900.
  • Bono P, et al. (2005) Layilin, a cell surface hyaluronan receptor, interacts with merlin and radixin. Exp Cell Res. 308(1):177-87.
  • Scoles DR. (2007) The merlin interacting proteins reveal multiple targets for NF2 therapy. Biochim Biophys Acta. 1785(1):32-54.
  • Chen Z, et al. (2008) Down-regulation of layilin, a novel hyaluronan receptor, via RNA interference, inhibits invasion and lymphatic metastasis of human lung A549 cells. Biotechnol Appl Biochem. 50(Pt 2):89-96.
  • Wegener KL, et al. (2008) Structural basis for the interaction between the cytoplasmic domain of the hyaluronate receptor layilin and the talin F3 subdomain. J Mol Biol. 382(1):112-26.
  • LAYN cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    LAYN cDNA ORF Clone in Cloning Vector, Rhesus CG90160-G
    LAYN cDNA ORF Clone, Rhesus, untagged CG90160-UT
    LAYN cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90160-ACG
    LAYN Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90160-ACGLN
    LAYN cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90160-ACR
    LAYN cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90160-NF
    LAYN cDNA ORF Clone, Rhesus, C-His tag CG90160-CH
    LAYN cDNA ORF Clone, Rhesus, N-His tag CG90160-NH
    LAYN cDNA ORF Clone, Rhesus, C-HA tag CG90160-CY
    LAYN cDNA ORF Clone, Rhesus, N-HA tag CG90160-NY
    LAYN cDNA ORF Clone, Rhesus, C-Myc tag CG90160-CM
    LAYN cDNA ORF Clone, Rhesus, N-Myc tag CG90160-NM

    LAYN cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    LAYN cDNA ORF Clone in Cloning Vector, Rat RG80431-G
    LAYN cDNA ORF Clone, Rat, untagged RG80431-UT
    LAYN Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80431-ACGLN
    LAYN cDNA ORF Clone, Rat, C-GFPSpark® tag RG80431-ACG
    LAYN cDNA ORF Clone, Rat, C-OFPSpark® tag RG80431-ACR
    LAYN cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80431-CF
    LAYN cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80431-NF
    LAYN cDNA ORF Clone, Rat, C-His tag RG80431-CH
    LAYN cDNA ORF Clone, Rat, N-His tag RG80431-NH
    LAYN cDNA ORF Clone, Rat, C-HA tag RG80431-CY
    LAYN cDNA ORF Clone, Rat, N-HA tag RG80431-NY
    LAYN cDNA ORF Clone, Rat, C-Myc tag RG80431-CM
    LAYN cDNA ORF Clone, Rat, N-Myc tag RG80431-NM
    LAYN qPCR Primer Pairs, Rat RP300404

    LAYN cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LAYN cDNA ORF Clone in Cloning Vector, Human HG10208-M
    LAYN cDNA ORF Clone, Human, untagged HG10208-UT
    LAYN Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10208-ACGLN
    LAYN cDNA ORF Clone, Human, C-GFPSpark® tag HG10208-ACG
    LAYN cDNA ORF Clone, Human, C-OFPSpark® tag HG10208-ACR
    LAYN cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10208-CF
    LAYN cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10208-NF
    LAYN cDNA ORF Clone, Human, C-His tag HG10208-CH
    LAYN cDNA ORF Clone, Human, N-His tag HG10208-NH
    LAYN cDNA ORF Clone, Human, C-HA tag HG10208-CY
    LAYN cDNA ORF Clone, Human, N-HA tag HG10208-NY
    LAYN cDNA ORF Clone, Human, C-Myc tag HG10208-CM
    LAYN cDNA ORF Clone, Human, N-Myc tag HG10208-NM
    LAYN qPCR Primer Pairs, Human HP100267
    info info
    添加购物车成功! 添加购物车失败!