필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
필리핀원숭이 LOC102130101 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001284821.1
cDNA 크기:306bp
cDNA 설명:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) small ubiquitin-related modifier 1-like.
유전자 동의어:LOC102130101
:Cynomolgus
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid on other vectors
필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90733-ACG383160
필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90733-ACR383160
필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그CG90733-ANG383160
필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그CG90733-ANR383160
필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90733-CF347790
필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-His 태그CG90733-CH347790
필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90733-CM347790
필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-HA 태그CG90733-CY347790
필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone in cloning vectorCG90733-G88420
필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90733-NF347790
필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-His 태그CG90733-NH347790
필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90733-NM347790
필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-HA 태그CG90733-NY347790
필리핀원숭이 small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmidCG90733-UT347790
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: CG90733-UT
정가: 
가격:      (You Save: )
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".