Text Size:AAA

붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
    필리핀원숭이 LOC701810 cDNA 클론 제품 정보
    Gene_bank_ref_id:XM_001096089.1
    cDNA 크기:687bp
    cDNA 설명:Full length Clone DNA of Macaca mulatta (Rhesus monkey) BTB/POZ domain-containing protein KCTD6-like.
    유전자 동의어:LOC701810
    :Rhesus
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone expression plasmid on other vectors
    붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90744-ACG383160
    붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90744-ACR383160
    붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그CG90744-ANG383160
    붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그CG90744-ANR383160
    붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90744-CF347790
    붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone expression plasmid, C-His 태그CG90744-CH347790
    붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90744-CM347790
    붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone expression plasmid, C-HA 태그CG90744-CY347790
    붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone in cloning vectorCG90744-G88420
    붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90744-NF347790
    붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone expression plasmid, N-His 태그CG90744-NH347790
    붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90744-NM347790
    붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone expression plasmid, N-HA 태그CG90744-NY347790
    붉은털원숭이 BTB/POZ domain-containing 단백질 KCTD6-like Gene ORF cDNA clone expression plasmidCG90744-UT347790
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    Size / Price
    Cat No: CG90744-UT
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".