MPDU1 cDNA ORF Clone, Rhesus, N-HA tag

Cat: CG90405-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MPDU1 Reagents

CRO Services

Product recommended


All MPDU1 Reagents

MPDU1 cDNA ORF Clone, Rhesus, N-HA tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
744 bp
Description
Full length Clone DNA of Rhesus mannose-P-dolichol utilization defect 1 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MPDU1 Background Information

Full Name
mannose-P-dolichol utilization defect 1

MPDU1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
MPDU1 cDNA ORF Clone in Cloning Vector, Rhesus CG90405-G
MPDU1 cDNA ORF Clone, Rhesus, untagged CG90405-UT
MPDU1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90405-ACG
MPDU1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90405-ACGLN
MPDU1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90405-ANG
MPDU1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90405-ACR
MPDU1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90405-ANR
MPDU1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90405-CF
MPDU1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90405-NF
MPDU1 cDNA ORF Clone, Rhesus, C-His tag CG90405-CH
MPDU1 cDNA ORF Clone, Rhesus, N-His tag CG90405-NH
MPDU1 cDNA ORF Clone, Rhesus, C-HA tag CG90405-CY
MPDU1 cDNA ORF Clone, Rhesus, C-Myc tag CG90405-CM
MPDU1 cDNA ORF Clone, Rhesus, N-Myc tag CG90405-NM

MPDU1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MPDU1 cDNA ORF Clone in Cloning Vector, Mouse MG5A3237-U
MPDU1 cDNA ORF Clone, Mouse, untagged MG5A3237-UT
MPDU1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3237-ACG
MPDU1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3237-ACGLN
MPDU1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3237-ACR
MPDU1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3237-CF
MPDU1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3237-NF
MPDU1 cDNA ORF Clone, Mouse, C-His tag MG5A3237-CH
MPDU1 cDNA ORF Clone, Mouse, N-His tag MG5A3237-NH
MPDU1 cDNA ORF Clone, Mouse, C-HA tag MG5A3237-CY
MPDU1 cDNA ORF Clone, Mouse, N-HA tag MG5A3237-NY
MPDU1 cDNA ORF Clone, Mouse, C-Myc tag MG5A3237-CM
MPDU1 cDNA ORF Clone, Mouse, N-Myc tag MG5A3237-NM

MPDU1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MPDU1 cDNA ORF Clone in Cloning Vector, Human HG21697-U
MPDU1 cDNA ORF Clone, Human, untagged HG21697-UT
MPDU1 cDNA ORF Clone, Human, C-GFPSpark® tag HG21697-ACG
MPDU1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21697-ACGLN
MPDU1 cDNA ORF Clone, Human, C-OFPSpark® tag HG21697-ACR
MPDU1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21697-CF
MPDU1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21697-NF
MPDU1 cDNA ORF Clone, Human, C-His tag HG21697-CH
MPDU1 cDNA ORF Clone, Human, N-His tag HG21697-NH
MPDU1 cDNA ORF Clone, Human, C-HA tag HG21697-CY
MPDU1 cDNA ORF Clone, Human, N-HA tag HG21697-NY
MPDU1 cDNA ORF Clone, Human, C-Myc tag HG21697-CM
MPDU1 cDNA ORF Clone, Human, N-Myc tag HG21697-NM
info info
添加购物车成功! 添加购物车失败!