필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
Cynomolgus MSRA cDNA 클론 제품 정보
Gene_bank_ref_id:XM_005562601.1
cDNA 크기:579bp
cDNA 설명:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) methionine sulfoxide reductase A with N terminal HA tag.
유전자 동의어:MSRA
:Cynomolgus
벡터:pCMV3-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, N-HA 태그 on other vectors
필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그CG90429-ACG265260
필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그CG90429-ACR265260
필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그CG90429-ANG265260
필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그CG90429-ANR265260
필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, C-Flag 태그CG90429-CF229890
필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, C-His 태그CG90429-CH229890
필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, C-Myc 태그CG90429-CM229890
필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, C-HA 태그CG90429-CY229890
필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone in cloning vectorCG90429-G88420
필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, N-Flag 태그CG90429-NF229890
필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, N-His 태그CG90429-NH229890
필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, N-Myc 태그CG90429-NM229890
필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, N-HA 태그CG90429-NY229890
필리핀원숭이 MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmidCG90429-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: CG90429-NY
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
대량 주문 문의장바구니에 추가
Contact Us
이미지
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".