PEMT cDNA ORF Clone, Rhesus, C-His tag

Cat: CG90359-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PEMT Reagents
CRO Services
Product recommended

All PEMT Reagents
PEMT cDNA ORF Clone, Rhesus, C-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
711 bp
Description
Full length Clone DNA of Rhesus phosphatidylethanolamine N-methyltransferase with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PEMT Background Information
Full Name
phosphatidylethanolamine N-methyltransferase

PEMT cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
PEMT cDNA ORF Clone in Cloning Vector, Rhesus CG90359-G
PEMT cDNA ORF Clone, Rhesus, untagged CG90359-UT
PEMT cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90359-ACG
PEMT Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90359-ACGLN
PEMT cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90359-ANG
PEMT cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90359-ACR
PEMT cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90359-ANR
PEMT cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90359-CF
PEMT cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90359-NF
PEMT cDNA ORF Clone, Rhesus, N-His tag CG90359-NH
PEMT cDNA ORF Clone, Rhesus, C-HA tag CG90359-CY
PEMT cDNA ORF Clone, Rhesus, N-HA tag CG90359-NY
PEMT cDNA ORF Clone, Rhesus, C-Myc tag CG90359-CM
PEMT cDNA ORF Clone, Rhesus, N-Myc tag CG90359-NM

PEMT cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PEMT cDNA ORF Clone in Cloning Vector, Mouse MG53652-U
PEMT cDNA ORF Clone, Mouse, untagged MG53652-UT
PEMT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53652-ACG
PEMT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53652-ACGLN
PEMT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53652-ACR
PEMT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53652-CF
PEMT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53652-NF
PEMT cDNA ORF Clone, Mouse, C-His tag MG53652-CH
PEMT cDNA ORF Clone, Mouse, N-His tag MG53652-NH
PEMT cDNA ORF Clone, Mouse, C-HA tag MG53652-CY
PEMT cDNA ORF Clone, Mouse, N-HA tag MG53652-NY
PEMT cDNA ORF Clone, Mouse, C-Myc tag MG53652-CM
PEMT cDNA ORF Clone, Mouse, N-Myc tag MG53652-NM

PEMT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PEMT cDNA ORF Clone in Cloning Vector, Human HG16729-U
PEMT cDNA ORF Clone, Human, untagged HG16729-UT
PEMT cDNA ORF Clone, Human, C-GFPSpark® tag HG16729-ACG
PEMT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16729-ACGLN
PEMT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12446-ACGLN
PEMT cDNA ORF Clone, Human, N-GFPSpark® tag HG16729-ANG
PEMT cDNA ORF Clone, Human, C-OFPSpark® tag HG16729-ACR
PEMT cDNA ORF Clone, Human, N-OFPSpark® tag HG16729-ANR
PEMT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16729-CF
PEMT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16729-NF
PEMT cDNA ORF Clone, Human, C-His tag HG16729-CH
PEMT cDNA ORF Clone, Human, N-His tag HG16729-NH
PEMT cDNA ORF Clone, Human, C-HA tag HG16729-CY
PEMT cDNA ORF Clone, Human, N-HA tag HG16729-NY
PEMT cDNA ORF Clone, Human, C-Myc tag HG16729-CM
PEMT cDNA ORF Clone, Human, N-Myc tag HG16729-NM
PEMT qPCR Primer Pairs, Human HP104786
info info
添加购物车成功! 添加购物车失败!