After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

Rhesus PPP2R2D natural ORF mammalian expression plasmid

데이터시트리뷰관련제품프로토콜
Cynomolgus PPP2R2D cDNA 클론 제품 정보
Gene_bank_ref_id:XM_001091312.2
cDNA 크기:867bp
cDNA 설명:Full length Clone DNA of Macaca mulatta (Rhesus monkey) serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B delta isoform-like.
유전자 동의어:PPP2R2D
:Rhesus
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Cat No: CG90762-UT
정가:   (Save )
가격:      [How to order]
재고정보
 배송안내
이미지
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".