PSMD13 cDNA ORF Clone, Cynomolgus, untagged

Cat: CG90760-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PSMD13 Reagents
CRO Services
Product recommended

All PSMD13 Reagents
PSMD13 cDNA ORF Clone, Cynomolgus, untagged General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1131 bp
Description
Full length Clone DNA of Cynomolgus proteasome (prosome, macropain) 26S subunit, non-ATPase, 13.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMD13 Background Information
Full Name
proteasome (prosome, macropain) 26S subunit, non-ATPase, 13

PSMD13 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
PSMD13 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90760-G
PSMD13 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90760-ACG
PSMD13 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90760-ACGLN
PSMD13 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90760-ANG
PSMD13 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90760-ACR
PSMD13 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90760-ANR
PSMD13 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90760-CF
PSMD13 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90760-NF
PSMD13 cDNA ORF Clone, Cynomolgus, C-His tag CG90760-CH
PSMD13 cDNA ORF Clone, Cynomolgus, N-His tag CG90760-NH
PSMD13 cDNA ORF Clone, Cynomolgus, C-HA tag CG90760-CY
PSMD13 cDNA ORF Clone, Cynomolgus, N-HA tag CG90760-NY
PSMD13 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90760-CM
PSMD13 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90760-NM

PSMD13 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PSMD13 cDNA ORF Clone in Cloning Vector, Rat RG87133-U
PSMD13 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87133-ACGLN

PSMD13 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMD13 cDNA ORF Clone in Cloning Vector, Mouse MG51586-G
PSMD13 cDNA ORF Clone, Mouse, untagged MG51586-UT
PSMD13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51586-ACG
PSMD13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51586-ACGLN
PSMD13 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51586-ANG
PSMD13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51586-ACR
PSMD13 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51586-ANR
PSMD13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51586-CF
PSMD13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51586-NF
PSMD13 cDNA ORF Clone, Mouse, C-His tag MG51586-CH
PSMD13 cDNA ORF Clone, Mouse, N-His tag MG51586-NH
PSMD13 cDNA ORF Clone, Mouse, C-HA tag MG51586-CY
PSMD13 cDNA ORF Clone, Mouse, N-HA tag MG51586-NY
PSMD13 cDNA ORF Clone, Mouse, C-Myc tag MG51586-CM
PSMD13 cDNA ORF Clone, Mouse, N-Myc tag MG51586-NM
PSMD13 qPCR Primer Pairs, Mouse MP201469

PSMD13 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMD13 cDNA ORF Clone in Cloning Vector, Human HG19931-U
PSMD13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19931-ACGLN
info info
添加购物车成功! 添加购物车失败!