RAB11B cDNA ORF Clone, Rhesus, C-HA tag

Cat: CG90395-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RAB11B Reagents

CRO Services

Product recommended


All RAB11B Reagents

RAB11B cDNA ORF Clone, Rhesus, C-HA tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
657 bp
Description
Full length Clone DNA of Rhesus RAB11B, member RAS oncogene family with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB11B Background Information

Full Name
RAB11B, member RAS oncogene family

RAB11B cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
RAB11B cDNA ORF Clone in Cloning Vector, Rhesus CG90395-G
RAB11B cDNA ORF Clone, Rhesus, untagged CG90395-UT
RAB11B Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90395-ACGLN
RAB11B cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90395-ACG
RAB11B cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90395-ANG
RAB11B cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90395-ACR
RAB11B cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90395-ANR
RAB11B cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90395-CF
RAB11B cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90395-NF
RAB11B cDNA ORF Clone, Rhesus, C-His tag CG90395-CH
RAB11B cDNA ORF Clone, Rhesus, N-His tag CG90395-NH
RAB11B cDNA ORF Clone, Rhesus, N-HA tag CG90395-NY
RAB11B cDNA ORF Clone, Rhesus, C-Myc tag CG90395-CM
RAB11B cDNA ORF Clone, Rhesus, N-Myc tag CG90395-NM

RAB11B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAB11B cDNA ORF Clone in Cloning Vector, Rat RG84698-U
RAB11B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84698-ACGLN

RAB11B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB11B cDNA ORF Clone in Cloning Vector, Mouse MG52358-U
RAB11B cDNA ORF Clone, Mouse, untagged MG52358-UT
RAB11B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52358-ACGLN
RAB11B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52358-ACG
RAB11B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52358-ANG
RAB11B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52358-ACR
RAB11B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52358-ANR
RAB11B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52358-CF
RAB11B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52358-NF
RAB11B cDNA ORF Clone, Mouse, C-His tag MG52358-CH
RAB11B cDNA ORF Clone, Mouse, N-His tag MG52358-NH
RAB11B cDNA ORF Clone, Mouse, C-HA tag MG52358-CY
RAB11B cDNA ORF Clone, Mouse, N-HA tag MG52358-NY
RAB11B cDNA ORF Clone, Mouse, C-Myc tag MG52358-CM
RAB11B cDNA ORF Clone, Mouse, N-Myc tag MG52358-NM
RAB11B qPCR Primer Pairs, Mouse MP202231

RAB11B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB11B cDNA ORF Clone in Cloning Vector, Human HG15636-G
RAB11B cDNA ORF Clone, Human, untagged HG15636-UT
RAB11B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15636-ACGLN
RAB11B cDNA ORF Clone, Human, C-GFPSpark® tag HG15636-ACG
RAB11B cDNA ORF Clone, Human, C-OFPSpark® tag HG15636-ACR
RAB11B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15636-CF
RAB11B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15636-NF
RAB11B cDNA ORF Clone, Human, C-His tag HG15636-CH
RAB11B cDNA ORF Clone, Human, N-His tag HG15636-NH
RAB11B cDNA ORF Clone, Human, C-HA tag HG15636-CY
RAB11B cDNA ORF Clone, Human, N-HA tag HG15636-NY
RAB11B cDNA ORF Clone, Human, C-Myc tag HG15636-CM
RAB11B cDNA ORF Clone, Human, N-Myc tag HG15636-NM
RAB11B qPCR Primer Pairs, Human HP104254
info info
添加购物车成功! 添加购物车失败!